FLUORESCENT PCR ASSOCIATED WITH CAPILLARY ELECTROPHORESIS AS A DIAGNOSTIC TOOL OF BACTERIA IN SEMEN

Authors

  • Francisca E. Ferreira Dias Universidade Federal do Tocantins
  • Cáris Marone Nunes Profs. Adjunto - Faculdade de Odontologia /Curso de Medicina Veterinária, UNESP Campus-Araçatuba
  • Tânia Vasconcelos Cavalcante Profs. Adjunto - Escola de Medicina Veterinária e Zootecnia - UFT
  • Andréa A. Pires de Castro Doutoranda da UFT- Pesquisadora da Fundação de Medicina Tropical do Tocantins
  • Jorge Luis Ferreira Profs. Adjunto - Escola de Medicina Veterinária e Zootecnia - UFT
  • José Fernando Garcia Profs. Adjunto - Faculdade de Odontologia /Curso de Medicina Veterinária, UNESP Campus-Araçatuba

DOI:

https://doi.org/10.5216/cab.v14i3.7638

Keywords:

Animal reproduction

Abstract

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (100 to 107 bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF–5’gcgctcaggctgccgacgcaa3’ (6-FAM labeled) and BR–5´accagccattgcggtcggta3’ for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 103 bacteria/mL, while for silver stained 8% poliacrylamide gel it was 105 bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

KEYWORDS: bovine semen; Brucella abortus; capillary electrophoresis; diagnostic fluorescent PCR.

Downloads

Download data is not yet available.

Author Biography

Francisca E. Ferreira Dias, Universidade Federal do Tocantins

Possui graduação em Medicina Veterinária pela Universidade Estadual do Ceará (1997), graduação em Bacharel em Economia Doméstica pela Universidade Federal do Ceará (1990), Mestrado em Ciências Veterinárias pela Universidade Estadual do Ceará (2000) e Doutorado em Medicina Veterinária pela Universidade Estadual Paulista Júlio de Mesquita Filho, Campus de Jaboticabal (2005). Atualmente é Professora Adjunta I da Universidade Federal do Tocantins, no Cursos de Medicina Veterinária e Zootecnia. Tem experiência na área de Medicina Veterinária, com ênfase Reprodução Animal.

Downloads

Published

2013-09-29

How to Cite

FERREIRA DIAS, F. E.; NUNES, C. M.; CAVALCANTE, T. V.; CASTRO, A. A. P. de; FERREIRA, J. L.; GARCIA, J. F. FLUORESCENT PCR ASSOCIATED WITH CAPILLARY ELECTROPHORESIS AS A DIAGNOSTIC TOOL OF BACTERIA IN SEMEN. Brazilian Animal Science/ Ciência Animal Brasileira, Goiânia, v. 14, n. 3, p. 366–372, 2013. DOI: 10.5216/cab.v14i3.7638. Disponível em: https://revistas.ufg.br/vet/article/view/7638. Acesso em: 17 jul. 2024.

Issue

Vol. 14 No. 3 (2013)

Section

Veterinary Medicine

License

Authors who publish with this journal agree to the following terms:

  1. Authors retain copyright and grant the journal right of first publication with the work simultaneously licensed under a Creative Commons Attribution License that allows others to share the work with an acknowledgement of the work's authorship and initial publication in this journal.
  2. Authors are able to enter into separate, additional contractual arrangements for the non-exclusive distribution of the journal's published version of the work (e.g., post it to an institutional repository or publish it in a book), with an acknowledgement of its initial publication in this journal.
  3. Authors are permitted and encouraged to post their work online (e.g. in institutional repositories or on their website) prior to and during the submission process, as it can lead to productive exchanges, as well as earlier and greater citation of published work (See The Effect of Open Access).