Antibiotic resistance gene occurrence in poultry farms in northeast Brazil

Almeida, Henrique Francisco de; Trindade, Paulo Ricardo Conceição Marques; Teixeira, César Roberto Viana; Brito, Claudson Oliveira; Dolabella, Silvio Santana; Jain, Sona; Martins, Maíra Pompeu; Barbosa, Ana Andréa Teixeira

doi:10.1590/1809-6891v26e-79298E

Abstract

The misuse of antibiotics in food-producing animal farming practices exerts selective pressure on bacterial strains, intensifying the spread of pathogenic and commensal bacteria carrying antibiotic resistance genes (ARGs). We conducted a study aiming to investigate ARGs in chicken litter from farms in the State of Sergipe, Northeast Brazil. A total of 14 chicken litter samples were collected from twelve farms and subjected to total DNA extraction. The presence of ARGs in the obtained material was tested by Polymerase Chain Reaction (PCR) using primers for selected ARGs. ARGs were confirmed in all samples, and the highest resistance positivity was obtained for tetracyclines (tetA, tetM, and tetG), quinolones (gyrA and qnrS), beta-lactams (blaTEM), macrolides (ermB) and sulfonamides (sul-1 ). Sequencing and comparison with the GenBank database confirmed the identity of the ARGs. Some of the sequences that were amplified by PCR were similar to resistance factors found in Gram-positive and Gram-negative bacteria of different species, mostly enterobacteria. Furthermore, similarity was observed for resistance determinants located both on the chromosome and on plasmids, transposons, and integrons. Our results indicate the potential of poultry farming for the environmental dissemination of ARGs in the State of Sergipe.

Keywords:
Antibiotic-resistant bacteria; poultry manure; environmental dissemination; antimicrobial; avian

Resumo

O uso indevido de antibióticos na produção animal pode exercer pressão seletiva sobre cepas bacterianas, intensificando a disseminação de bactérias patogênicas e comensais portadoras de genes de resistência a antibióticos (GRAs). O objetivo deste estudo foi investigar a presença de GRAs em camas de frango provenientes de granjas avícolas localizadas no Estado de Sergipe, no Nordeste do Brasil. Um total de 14 amostras de cama de frango foram coletadas de doze fazendas e submetidas à extração de DNA total. A presença de GRAs foi testada por Reação em Cadeia da Polimerase (PCR) usando primers para principais classes de antibióticos. GRAs foram confirmados em todas as amostras, e a maior positividade para resistência foi obtida para tetraciclinas (tetA, tetM, and tetG), quinolonas (gyrA and qnrS), beta-lactâmicos (blaTEM), macrolídeos (ermB) e sulfonamidas (sul-1). O sequenciamento e a comparação com o banco de dados GenBank confirmaram a identidade dos GRAs. Algumas das sequências amplificadas por PCR eram semelhantes a fatores de resistência encontrados em bactérias Gram-positivo e Gram-negativo de diferentes espécies, principalmente enterobactérias. Além disso, foi observada semelhança para determinantes de resistência localizados tanto no cromossomo quanto em plasmídeos, transposons e integrons. Nossos resultados indicam o potencial da criação de aves para a disseminação ambiental de GRAs no Estado de Sergipe.

1. Introduction

The use of antibiotics in food-producing animals, particularly in chicken production, for prophylactic and therapeutic purposes as well as growth promoters has been identified as one of the activities that lead to the spread of antibiotic resistance in the environment (¹,²). Antibiotic resistance has become a serious and widespread public health problem, and farming activities can intensify the spread of pathogenic and commensal bacteria carrying antibiotic resistance genes (ARGs) (³,⁴,⁵). Antibiotic resistance determinants include antibiotics, antibiotic-resistant bacteria (ARB) and ARGs. When bacteria are in the environment, antibiotics can kill ARBs and allow commensal strains to get ARGs through horizontal gene transfer (HGT)(⁶,⁷,⁸). In the environment, these resistance determinants can reach human and animal pathogenic bacterial strains, representing a serious problem (⁹,¹⁰).

Poultry production eliminates antibiotic resistance determinants in poultry excreta, which forms the widely used organic fertilizer (¹¹,¹²,¹³). Some studies have shown that the use of poultry manure as fertilizer is responsible for the introduction of ARB and ARGs into the soil (¹⁴,¹⁵,¹⁶), resulting in the accumulation and absorption of these micropollutants by plants, thus reaching humans and animals through the food chain (⁹,¹⁰,¹⁵).

Since the late 1990s, Brazil has observed a progressive reduction in the use of antibiotic agents as growth promoters in animals (¹⁷). The Ministry of Agriculture, Livestock and Food Supply (MAPA) implemented the Antimicrobial Resistance Surveillance and Monitoring Program, through Normative Instructions, prohibiting the use of tetracyclines, beta-lactams (benzylpenicillin and cephalosporins), quinolones, sulfonamides, Colistin, tylosin, lincomycin, and tiamulin as growth promoters, aiming to contain the advance of antimicrobial resistance (¹⁷,¹⁸,¹⁹,²⁰). Despite restrictive surveillance measures, the available Brazilian data on this topic reveal a wide variety of resistance profiles (²¹).

Consideringthegrowing consumption of antibiotics in animal production, despite efforts to reduce their use and the relevance of Brazil as a food producer and exporter of poultry meat, the aim of the present study was to verify the presence of ARGs in poultry manure from different farms located in Sergipe state, Northeast Brazil.

2. Material and methods

2.1. Study area and sample collection

A total of 14 samples were collected, with ten (10) originating from poultry litter (poultry broiler) and four (4) from the poultry manure layer (designated as G1 to G14 in Table 1). These samples were gathered from twelve farms situated across seven municipalities in the State of Sergipe, Brazil, spanning the period from September 2021 to February 2022. Specifically, the sampling points were distributed as follows: Estância (n=5), Areia Branca (n=4), Umbaúba (n=1 ), Nossa Senhora da Glória (n=1), Carira (n=1), Frei Paulo (n=1), and Campo do Brito (n=1). Figure 1 displays the locations of the municipalities included in the study.

Thumbnail

Table 1
Identification of the samples with their respective municipalities, type of poultry production and growth promoter used.

Figure 1
The state of Sergipe, Brazil, and the locations of the municipalities in the study area (highlighted in orange).

Samples from G11 to G14 were collected from the same farm, representing distinct phases of chicken development: G11 during the brooding phase, encompassing the first ten weeks of the hens' lives; G12 during the rearing phase, spanning from the 10th and 17th week of development; and G13 and G14 at the beginning and end, respectively, of the laying phase, covering the 18th to the 72nd week of the chicken growth cycle (²²). To create a composite sample, a minimum of 20 subsamples were collected using the zigzag method and subsequently homogenized to produce a fraction of approximately 300 g (total sample). These samples were then placed in plastic bags, labeled for identification, and transported to the Animal Science Department of the Federal University of Sergipe. The samples were stored at -20°C until further processing and analysis. Detailed information regarding the samples collected in this study is provided in Table 1.

2.2. Sample processing and DNA extraction

Sample processing was performed according to Subirais et al. (²³), with adaptations. From the total sample of chicken litter, 20 g was diluted in 200 mL of saline solution (0.85% NaCI), and the suspensions were manually stirred for approximately five minutes. Then, the samples were filtered, distributed in 50 mL Falcon tubes, and centrifuged (5000 rpm for 12 minutes at 4°C). The supernatant was discarded, and the pellet was washed twice with a saline solution (5000 rpm for 12 minutes at 4°C). The pellet was resuspended in saline solution and stored at -20°C until DNA extraction. For DNA extraction, the QIAamp Fast DNA Stool Kit (QIAGEN, Valencia, CA, United States) was used according to the manufacturer's instructions. Quantification of the extracted genetic material was performed using a spectrophotometer (Epoch, Microplate Spectrophotometer, Biotek, Agilent®).

2.3. Detection of antibiotic resistance genes

The extracted DNA was subjected to polymerase chain reaction (PCR) using primers to first detect the 16S rRNA (control) and later to identify the key resistance genes that have been linked to poultry farming (Table 2) using the following conditions: initial denaturation at 95°C for 5 minutes; followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing from 55°C to 60°C (30 seconds), and extension at 72°C for 30 seconds. The final extension was performed at 72°C for 10 minutes. The positive controls for the tetA, tetB and mcr-1 genes were isolated from a strain of Klebsiella pneumoniae(⁵⁶) and provided by the Laboratory of Molecular Genetics of Bacteria of the Federal University of Viçosa- Minas Gerais. For the other evaluated genes, positive controls were provided by the Laboratory of Molecular Biology at Federal University of Sergipe (²⁴).

Thumbnail

Table 2
Primers used for the detection of 16S rRNA and antibiotic resistance genes in poultry litter samples.

2.4. Sequencing

The PCR-amplified bands were purified using the Promega Purification Kit, quantified using a spectrophotometer (Epoch, Microplate Spectrophotometer, Biotek, Agilent®) and sequenced at the Federal University of Pernambuco, Brazil. The sequences obtained were compared using the BLAST Basic Local Alignment Search Tool (GenBank, NCBI – National Center for Biotechnology Information). Samples for sequencing were chosen based on the strongest amplification performance of a single gene from each farm.

3. Results

3.1 Detection of ARGs

All tested samples were positive for at least one of the investigated ARGs. Five of the tested genes, tetM, gyrA, blaTEM, ermB, and sul-1, were positive in all analyzed samples (Table 3). The qnrS and mcr-1 were not detected in samples G13 and G14, respectively. All tetracycline resistance genes were detected in samples G1 (Estância), G3 (Estância), G5 (Umbaúba), G7 (Nossa Senhora da Glória) and G9 (Campo do Brito), obtained from poultry litter, highlighting the spread of antimicrobial resistance genes in Sergipe State poultry farms. Samples Gl, G3 and G5 exhibited positive results for all the primers tested (Table 3).

Thumbnail

Table 3
Detection frequency of antibiotic resistance genes in poultry farms samples (G1 to G14) collected from September 2021 to february 2022, Sergipe State, Brazil.

3.2 Sequencing

Sequencing and comparison with the GenBank database confirmed the identity of the genes (Table 4). They showed similarity with resistance determinants present in bacteria of different species, demonstrating their ubiquitous character. The results were the same for both Gram-positive and Gram-negative strains, with enterobacteria being the most similar. This was to be expected since the samples came from birds' digestive systems (²,⁷,¹²) (Table 4).

Thumbnail

Table 4
Result of sequencing analysis of antibiotic resistance genes amplified from chicken litter samples using GenBank database.

For tetA gene, the analyzed sequence showed a 100% identity with genes present in the genome of strains of Escherichia coli, Shigella flexneri, Salmonella enterica, and Klebsiella pneumoniae. A 100% identity was also observed with Acinetobacter baumannii for tetB, while other strains, such as Vibrio cholerae, showed a 99.85% identity (Table 4). Among the tetracycline genes, tetG showed lower identity with reference strains: the highest identity recorded was 92.27% with an uncultured bacterial clone. Other strains like Proteus mirabilis and Pseudomonas aeruginosa showed lower identity percentages around 90.34%. For tetM, all strains analyzed had a 95.79% identity, including those from Streptococcus agalactiae and Enterococcus faecalis (Table 4).

High identity percentages of 100% with gyrA gene were noted for E. coli and Salmonella sp., while S. flexneri and Shigella dysenteriae had identities of around 99.35% and 99.68%, respectively. Complete sequences from various K. pneumoniae and P. aeruginosa strains showed 100% identity with gene qnrS (Table 4). For blaTEM, identity percentages ranged from 99.71% for multiple strains, including E. coli and A. baumannii. The ermB gene showed 99.05% identity with genetic determinants from Streptococcus suis, Clostridium perfringens, and E. faecalis. The sequence of sul1 gene exhibited a 100% identity with genetic determinants from Enterobacter cloacae, E. coli and K. pneumoniae. For mcrA gene, 100% identity was found with genes located in the genome of E. coli and K. pneumoniae, Salmonella Typhimurium and Raoultella ornithinolytica (Table 4).

4. Discussion

The use of antimicrobial substances in food-producing animals leads to extensive human exposure to bacteria carrying ARGs, including commensal bacteria present in poultry droppings(¹²). In poultry farms, the extensive distribution of resistant bacteria and their related genes poses a recognized threat to human and animal health (²,³). In our results, the tetM, gyrA, blaTEM, ermB and sul-1 genes were detected in all analyzed samples (Table 3). These ARGs confer resistance to tetracyclines, quinolones, beta-lactams, macrolides, and sulfonamides. These genes are among the most commonly detected genes in samples from poultry farming(³⁰,³¹). Eleven studied samples amplified tetA and tetG, while nine samples amplified tetB, the other genes conferring resistance to tetracyclines. Only two samples, G6 and G13 (Table 3), did not contain the qnrS gene, which encodes resistance to quinolones. Ten samples (Table 3) detected the mcr-1 gene, which encodes resistance to polymyxins, confirming its prevalence and persistence in poultry environments(³²,³³,³⁴).

The resistance determinants of the amplified ARGs, selected from the GenBank database, were located both on the chromosome and on plasmids, transposons and integrons, showing similarities. The presence of these genes in mobile genetic elements such as plasmids, transposons and integrons facilitates their propagation between species, which may significantly contribute to their dissemination in the environment(³⁵,³⁶,³⁷). Most bacterial strains selected from the database for similarity analysis had genes associated with both plasmids and chromosomes. Only one strain of Streptococcus agalactiae carried the tetM gene associated with transposon 7539, and one strain of Enterobacter cloacae had the sul-1 gene associated with class I integrons (Table 4). The macrolide resistance determinant ermB was found to be associated with the tetO gene in Streptococcus suis. During HGT events, both genes can be transferred simultaneously to another bacterial strain, leading to the spread of multidrug-resistant strains(³⁸).

These resistance genes are related to antibiotics, whose use as growth promoters is prohibited by Brazilian legislation(¹⁷). However, their use for disease prevention and treatment in animals is permitted under specific conditions and supervision.(³⁹). Therefore, the presence of these ARGs in most of the samples may be linked to the frequent use of these antibiotics for therapeutic or prophylactic purposes in poultry(³⁰,³¹). Data regarding antibiotic use for these two purposes during the poultry production cycle were not available from the farms under study, only information on growth promoters were available. The growth promoters used in the evaluated farms include enramycin (8%), Halquinol and the zinc bacitracin. Enramycin, a polypeptide antibiotic, primarily inhibits the synthesis of the cell wall in Gram-positive bacteria (⁴⁰,⁴¹). It ranks among the top three growth promoters, with high import rates of approximately 62.58 tons between 2017 and 2019, and is frequently added to chicken diets(⁴²). Enramycin was used by most of the farms included in this study (Table 1).

Halquinol is classified as a quinolone, but its mechanism of action differs from that of representatives of this class. It affects fungi and protozoa and is used as a growth promoter in swine and poultry farms(⁴³,⁴⁴). In this study, only four establishments used this additive (Table 1). To date, no cases of microorganisms resistant to Halquinol have been reported in the literature(⁴³,⁴⁴). Zinc bacitracin exhibits activity against Gram-positive bacteria and serves as a growth promoter in poultry. It is used in poultry production on two farms in the study area. It is used to treat C. perfringens infections in chickens and is also used topically in humans(⁴⁵,⁴⁶). However, its inappropriate and widespread use has led to an increase in the prevalence of bacitracin-resistant strains of C. perfringens(⁴⁷) and the detection of ARGs in foods such as meat, vegetables, and fruits(⁴⁸). The detection of the tetA, tetB, blaTEM and sul-1 genes in the present study may be related to the use of bacitracin in the studied farms. A study by Diarra et al.(⁴⁹) linked the use of bacitracin as a growth promoter to the presence of multiresistant E. coli harboring the tetA, tetB, blaTEM and sul-1 genes. The use of this growth promoter was also associated with the presence of the ARGs tetA and sul-1 in E. coli strains isolated from chickens(⁵⁰).

Monensin and salinomycin, authorized in Brazil for use as growth promoters in cattle, sheep and pigs, are used for prophylactic purposes in poultry to combat coccidiosis(⁵¹). Due to their frequent use in poultry farming, cases of Eimeria spp. resistant to these anticoccidials have been reported(⁵¹). Furthermore, the use of salinomycin as a growth promoter in chickens was associated with the isolation of E. coli carrying the following ARGs: tetA, tetB, blaTEM and sul-1(⁴⁹). All farms in the present study that used salinomycin as a growth promoter tested positive for these genes, except for G9, where tetB was not detected.

Therefore, the ARGs detected are not directly related to the drugs used as growth promoters on the farms under study. This is concerning, as it may indicate a lack of control over the use of antibiotics on farms or cross-resistance with growth promoters. It is important to note that despite global trends to reduce or prohibit the use of antibiotics in animal production, these measures do not effectively address the issue of bacterial resistance. The colistin resistance gene mcr-1, for example, has been shown to confer cross-resistance to bacitracin. Furthermore, mobile genetic elements such as plasmids, transposons, and integrons can carry various resistance determinants, facilitating the dissemination of HGT gene transfer(⁵²,⁵³). Thus, the detection of ARGs in this study can be attributed to direct antibiotic consumption during the poultry production cycle, as well as other factors not directly related to these drugs in chickens. In addition, there are no reports in the literature that correlate the use of enramycin and halquinol with the detection of ARGs on the study farms, highlighting the need for further research to address this gap. These ARGs confer resistance to critical antibiotics used in the treatment of infectious diseases in humans (⁵⁴).

The presence of these ARGs in chicken litter possesses a potential risk for their dissemination in the environment, particularly since using litter as fertilizer in plantations is a common practice (¹¹). An exacerbating factor is the repeated reuse of poultry litter across multiple growth cycles, which increases the diversity and concentration of ARGs and ARBs in poultry waste (⁷,¹¹). Most of the studied poultry farms reused chicken litter in multiple production cycles with only samples from G7, G8, and G9 having fresh litter (Table 1). Farm operators confirmed that they use the resulting manure in surrounding plantations. This practice promotes the spread of bacterial resistance by facilitating contact and genetic material exchange between enteric bacteria in manure and soil bacteria (⁴¹,⁵⁵).

5. Conclusion

This study evaluates poultry residues harboring ARGs, together with the potential risk they represent for the spread of bacterial resistance in the environment. These resistance determinants can reach humans through contact with contaminated soil, food and water, thereby increasing the risk of treatment failures of the infections caused by resistant microorganisms. The current study, a pioneer in Sergipe, Brazil, will thus help raising awareness among producers about the judicious use of antibiotics across all sectors of society, including animal husbandry. Proper treatment of litter and chicken manure before disposal into the environment is crucial. This approach can help poultry farming play a role in reducing the dissemination of bacterial resistance. Developing management strategies to mitigate the spread of antibiotics, ARBs, and ARGs is a priority for the animal production sector.

Data availability statement

The data will be provided upon request.

References

¹ van Cuong N, Kiet BT, Hien VB, Truong BD, Phu DH, Thwaites G, et al. Antimicrobial use through consumption of medicated feeds in chicken flocks in the Mekong Delta of Vietnam: A three-year study before a ban on antimicrobial growth promoters. PLoS One. 2021;16(4): e0250082. http://doi.org/10.1371/journal.pone.0250082
» https://doi.org/10.1371/journal.pone.0250082
² Langata LM, Maingi JM, Musonye HA, Kiiru J, Nyamache AK. Antimicrobial resistance genes in Salmonella and Escherichia coli isolates from chicken droppings in Nairobi, Kenya. BMC Research Notes. 2019;12(1):22. https://doi.org/10.1186/s13104-019-4068-8
» https://doi.org/10.1186/s13104-019-4068-8
³ Farooq M, Smoglica C, Ruffini F, Soldati L, Marsilio F, Di Francesco CE. Antibiotic resistance genes occurrence in conventional and antibiotic-free poultry farming, Italy. Animals (Basel). 2022;12(18):2310. https://doi.org/10.3390/ani12182310
» https://doi.org/10.3390/ani12182310
⁴ Huemer M, Mairpady Shambat S, Brugger SD, Zinkernagel AS. Antibiotic resistance and persistence - Implications for human health and treatment perspectives. EMBO Reports. 2020;21(12): e51034. https://doi.org/10.15252/embr.202051034
» https://doi.org/10.15252/embr.202051034
⁵ Larsson DGJ, Flach CF. Antibiotic resistance in the environment. Nature Reviews Microbiology. 2022;20(5):257–269. https://doi.org/10.1038/s41579-021-00649-x
» https://doi.org/10.1038/s41579-021-00649-x
⁶ Alalam H, Graf FE, Palm M, Abadikhah M, Zackrisson M, Boström J, et al. A high-throughput method for screening for genes controlling bacterial conjugation of antibiotic resistance. mSystems. 2020;5(6):e01226-20. https://doi.org/10.1128/mSystems.01226-20
» https://doi.org/10.1128/mSystems.01226-20
⁷ Oladeinde A, Abdo Z, Zwirzitz B, Woyda R, Lakin SM, Press MO, et al. Litter commensal bacteria can limit the horizontal gene transfer of antimicrobial resistance to Salmonella in chickens. Applied and Environmental Microbiology. 2022;88(9):e0251721. https://doi.org/10.1128/aem.02517-21
» https://doi.org/10.1128/aem.02517-21
⁸ Virolle C, Goldlust K, Djermoun S, Bigot S, Lesterlin C. Plasmid transfer by conjugation in Gram-negative bacteria: From the cellular to the community level. Genes (Basel). 2020;11(11):1239. https://doi.org/10.3390/genes11111239
» https://doi.org/10.3390/genes11111239
⁹ Lima T, Domingues S, Silva GJ Da. Manure as a potential hotspot for antibiotic resistance dissemination by horizontal gene transfer events. Veterinary Sciences. 2020;7(3):110. https://doi.org/10.3390/vetsci7030110
» https://doi.org/10.3390/vetsci7030110
¹⁰ Vumazonke S, Khamanga SM, Ngqwala NP. Detection of pharmaceutical residues in surface waters of the Eastern Cape Province. International Journal of Environmental Research and Public Health. 2020;17(11)4067. https://doi.org/10.3390/ijerph17114067
» https://doi.org/10.3390/ijerph17114067
¹¹ Ngogang MP, Ernest T, Kariuki J, Mouiche MMM, Ngogang J, Wade A, et al. Microbial contamination of chicken litter manure and antimicrobial resistance threat in an urban area setting in Cameroon. Antibiotics (Basel). 2021;10(1):20. https://doi.org/10.3390/antibiotics10010020
» https://doi.org/10.3390/antibiotics10010020
¹² Wang L, Chai B. Fate of antibiotic resistance genes and changes in bacterial community with increasing breeding scale of layer manure. Frontiers in Microbiology. 2022;13:857046. https://doi.org/10.3389/fmicb.2022.857046
» https://doi.org/10.3389/fmicb.2022.857046
¹³ Oxendine A, Walsh AA, Young T, Dixon B, Hoke A, Rogers EE, et al. Conditions necessary for the transfer of antimicrobial resistance in poultry litter. Antibiotics (Basel). 2023;12(6):1006. https://doi.org/10.3390/antibiotics12061006
» https://doi.org/10.3390/antibiotics12061006
¹⁴ Chen Q, An X, Li H, Su J, Ma Y, Zhu YG. Long-term field application of sewage sludge increases the abundance of antibiotic resistance genes in soil. Environment International. 2016;92–93:1–10. https://doi.org/10.1016/j.envint.2016.03.026
» https://doi.org/10.1016/j.envint.2016.03.026
¹⁵ Duan M, Gu J, Wang X, Li Y, Zhang R, Hu T, et al. Factors that affect the occurrence and distribution of antibiotic resistance genes in soils from livestock and poultry farms. Ecotoxicology and Environmental Safety. 2019;180:114–122. https://doi.org/10.1016/j.ecoenv.2019.05.005
» https://doi.org/10.1016/j.ecoenv.2019.05.005
¹⁶ Fatoba DO, Abia ALK, Amoako DG, Essack SY. Rethinking manure application: Increase in multidrug-resistant enterococcus spp. in agricultural soil following chicken litter application. Microorganisms. 2021;9(5):885. https://doi.org/10.3390/microorganisms9050885
» https://doi.org/10.3390/microorganisms9050885
¹⁷ Lentz SAM. Atualização sobre Uso Racional de Antimicrobianos e Boas Práticas de Produção. Opas/Mapa. 2022;1–50. Available from: https://www.gov.br/agricultura/pt-br/assuntos/insumos-agropecuarios/insumos-pecuarios/resistencia-aos-antimicrobianos/publicacoes/Apostila_AtualizaosobreUsoRacionaldeAntimicrobianoseBoasPrticasdeProduo.pdf
» https://www.gov.br/agricultura/pt-br/assuntos/insumos-agropecuarios/insumos-pecuarios/resistencia-aos-antimicrobianos/publicacoes/Apostila_AtualizaosobreUsoRacionaldeAntimicrobianoseBoasPrticasdeProduo.pdf
¹⁸ Brasil. Instrução Normativa Nº26, de 10 de julho de 2009. Ministério da Agricultura Pecuária e Abastecimento - MAPA. 2009;9. https://wikisda.agricultura.gov.br/dipoa_baselegal/in_9-2009_listeria.pdf
» https://wikisda.agricultura.gov.br/dipoa_baselegal/in_9-2009_listeria.pdf
¹⁹ Brasil. Instrução Normativa Nº 45, De 22 De Novembro De 2016. Dou. 2016;4. https://www.gov.br/agricultura/pt-br/assuntos/insumos-agropecuarios/insumos-pecuarios/alimentacao-animal/arquivos-alimentacao-animal/legislacao/instrucao-normativa-no-45-de-22-de-novembro-de-2016.pdf
» https://www.gov.br/agricultura/pt-br/assuntos/insumos-agropecuarios/insumos-pecuarios/alimentacao-animal/arquivos-alimentacao-animal/legislacao/instrucao-normativa-no-45-de-22-de-novembro-de-2016.pdf
²⁰ Brasil. Ministério da Saúde. Plano de Ação Nacional de Prevenção e Controle da Resistência aos Antimicrobianos no Âmbito da Saúde Única. 2019;1. https://bvsms.saude.gov.br/bvs/publicacoes/plano_prevencao_resistencia_antimicrobianos.pdfantimicrobianos/plano-nacional-antimicrobianos-pan-br-14fev19-isbn.pdf/view
» https://bvsms.saude.gov.br/bvs/publicacoes/plano_prevencao_resistencia_antimicrobianos.pdfantimicrobianos/plano-nacional-antimicrobianos-pan-br-14fev19-isbn.pdf/view
²¹ Rabello RF, Bonelli RR, Penna BA, Albuquerque JP, Souza RM, Cerqueira AMF. Antimicrobial resistance in farm animals in Brazil: An update overview. Animals (Basel). 2020;10(4):552. https://doi.org/10.3390/ani10040552
» https://doi.org/10.3390/ani10040552
²² SENAI. Manual de Segurança e Qualidade para a Avicultura de Postura Manual de Segurança e Qualidade para a Avicultura de Postura. Embrapa. 2004;1–100.
²³ Subirats J, Murray R, Scott A, Lau CHF, Topp E. Composting of chicken litter from commercial broiler farms reduces the abundance of viable enteric bacteria, Firmicutes, and selected antibiotic resistance genes. Science of the Total Environment. 2020;746:141113. https://doi.org/10.1016/j.scitotenv.2020.141113
» https://doi.org/10.1016/j.scitotenv.2020.141113
²⁴ Trindade, P. R. C. M., Dolabella, S. S., Jain, S., Nascimento, L. F. . de J., Sacramento, A. . G., Barbosa, F. H. F., & Teixeira Barbosa, A. A. (2024). Ocorrência e persistência de genes de resistência a antibióticos em estações de tratamento de esgoto em Aracaju/SE/Brasil. Scientia Plena, 20(10). https://doi.org/10.14808/sci.plena.2024.106201
» https://doi.org/10.14808/sci.plena.2024.106201
²⁵ Limayem A, Micciche A, Nayak B, Mohapatra S. Prokaryotic community profling of local algae wastewaters using advanced 16S rRNA gene sequencing. Environmental Science and Pollution Research. 2018;25(1):704–711. https://doi.org/10.1007/s11356-017-0078-z
» https://doi.org/10.1007/s11356-017-0078-z
²⁶ Cornejo J, Yevenes K, Avello C, Pokrant E, Maddaleno A, Martin BS, et al. Determination of chlortetracycline residues, antimicrobial activity and presence of resistance genes in droppings of experimentally treated broiler chickens. Molecules. 2018;23(6):1264. https://doi.org/10.3390/molecules23061264
» https://doi.org/10.3390/molecules23061264
²⁷ Jia J, Guan Y, Cheng M, Chen H, He J, Wang S, et al. Occurrence and distribution of antibiotics and antibiotic resistance genes in Ba River, China. Science of the Total Environment. 2018;642:1136–1144. https://doi.org/10.1016/j.scitotenv.2018.06.149
» https://doi.org/10.1016/j.scitotenv.2018.06.149
²⁸ Furlan JPR, dos Santos LDR, Moretto JAS, Ramos MS, Gallo IFL, Alves G de AD, et al. Occurrence and abundance of clinically relevant antimicrobial resistance genes in environmental samples after the Brumadinho dam disaster, Brazil. Science of the Total Environment. 2020;726:138100. https://doi.org/10.1016/j.scitotenv.2020.138100
» https://doi.org/10.1016/j.scitotenv.2020.138100
²⁹ Ayandiran TO, Falgenhauer L, Schmiede J, Chakraborty T, Ayeni FA. High resistance to tetracycline and ciprofloxacin in bacteria isolated from poultry farms in Ibadan, Nigeria. Journal of Infection in Developing Countries. 2018;12(6):462–470. https://doi.org/10.3855/jidc.9862
» https://doi.org/10.3855/jidc.9862
³⁰ Collignon PJ, McEwen SA. One health-its importance in helping to better control antimicrobial resistance. Tropical Medicine and Infectious Disease. 2019;4(1):22. https://doi.org/10.3390/tropicalmed4010022
» https://doi.org/10.3390/tropicalmed4010022
³¹ Gibson JS, Wai H, Oo SSML, Hmwe EMM, Wai SS, Htun LL, et al. Antimicrobials use and resistance on integrated poultry-fish farming systems in the Ayeyarwady Delta of Myanmar. Scientific Reports. 2020;10(1):16149. https://doi.org/10.1038/s41598-020-73076-2
» https://doi.org/10.1038/s41598-020-73076-2
³² Anyanwu MU, Jaja IF, Okpala COR, Jaja CJI, Oguttu JW, Chah KF, et al. Potential sources and characteristic occurrence of mobile colistin resistance (mcr) gene-harbouring bacteria recovered from the poultry sector: A literature synthesis specific to high-income countries. PeerJ. 2021;9:e11606. https://doi.org/10.7717/peerj.11606
» https://doi.org/10.7717/peerj.11606
³³ Wang Y, Lyu N, Liu F, Liu WJ, Bi Y, Zhang Z, et al. More diversified antibiotic resistance genes in chickens and workers of the live poultry markets. Environment International. 2021;153:106534. https://doi.org/10.1016/j.envint.2021.106534
» https://doi.org/10.1016/j.envint.2021.106534
³⁴ Xu S, Lu W, Qasim MZ. High-throughput characterization of the expressed antibiotic resistance genes in sewage sludge with transcriptional analysis. Ecotoxicology and Environmental Safety. 2020;205:111377. https://doi.org/10.1016/j.ecoenv.2020.111377
» https://doi.org/10.1016/j.ecoenv.2020.111377
³⁵ Yang Q, Tian T, Niu T, Wang P. Molecular characterization of antibiotic resistance in cultivable multidrug-resistant bacteria from livestock manure. Environmental Pollution. 2017 Oct 1;229:188–198. https://doi.org/10.1016/j.envpol.2017.05.073
» https://doi.org/10.1016/j.envpol.2017.05.073
³⁶ Leungtongkam U, Thummeepak R, Tasanapak K, Sitthisak S. Acquisition and transfer of antibiotic resistance genes in association with conjugative plasmid or class 1 integrons of Acinetobacter baumannii PLoS One. 2018;13(12):e0208468. https://doi.org/10.1371/journal.pone.0208468
» https://doi.org/10.1371/journal.pone.0208468
³⁷ Dionisio F, Zilhão R, Gama JA. Interactions between plasmids and other mobile genetic elements affect their transmission and persistence. Plasmid. 2019;102:29–36. https://doi.org/10.1016/j.plasmid.2019.01.003
» https://doi.org/10.1016/j.plasmid.2019.01.003
³⁸ Karim MR, Zakaria Z, Hassan L, Mohd Faiz N, Ahmad NI. Antimicrobial resistance profiles and co-existence of multiple antimicrobial resistance genes in mcr-harbouring colistin-resistant enterobacteriaceae isolates recovered from poultry and poultry meats in Malaysia. Antibiotics (Basel). 2023;12(6):1060. https://doi.org/10.3390/antibiotics12061060
» https://doi.org/10.3390/antibiotics12061060
³⁹ OIE. World Organisation for Animal Health. List of Antimicrobial Agents of Veterinary Importance. 2021, (Resolution No. XXVIII) Available from: https://www.woah.org/app/uploads/2021/06/a-oie-list-antimicrobials-june2021.pdf
» https://www.woah.org/app/uploads/2021/06/a-oie-list-antimicrobials-june2021.pdf
⁴⁰ Belote BL, Tujimoto-Silva A, Hümmelgen PH, Sanches AWD, Wammes JCS, Hayashi RM, et al. Histological parameters to evaluate intestinal health on broilers challenged with Eimeria and Clostridium perfringens with or without enramycin as growth promoter. Poultry Science. 2018;97(7):2287–2294. https://doi.org/10.3382/ps/pey064
» https://doi.org/10.3382/ps/pey064
⁴¹ Yang Y, Ashworth AJ, Willett C, Cook K, Upadhyay A, Owens PR, et al. Review of antibiotic resistance, ecology, dissemination, and mitigation in U.S. broiler poultry systems. Frontiers in Microbiology. 2019;10:2639. https://doi.org/10.3389/fmicb.2019.02639
» https://doi.org/10.3389/fmicb.2019.02639
⁴² Umair M, Orubu S, Zaman MH, Wirtz VJ, Mohsin M. Veterinary consumption of highest priority critically important antimicrobials and various growth promoters based on import data in Pakistan. PLoS One. 2022;17(9):e0273821. http://doi.org/10.1371/journal.pone.0273821
» https://doi.org/10.1371/journal.pone.0273821
⁴³ Basit MA, Kadir AA, Loh TC, Aziz SA, Salleh A, Zakaria ZA, et al. Comparative efficacy of selected phytobiotics with halquinol and tetracycline on gut morphology, ileal digestibility, cecal microbiota composition and growth performance in broiler chickens. Animals (Basel). 2020;10(11):2150. https://doi.org/10.3390/ani10112150
» https://doi.org/10.3390/ani10112150
⁴⁴ Habib MA, Haque MA, Islam MS, Liton MR. Effect of dietary Halquinol supplementation on the productive performances, carcass traits and blood profile of Sonali chicken. Asian Journal of Medical and Biological Research. 2020;5(4):316–323. https://doi.org/10.3329/ajmbr.v5i4.45270
» https://doi.org/10.3329/ajmbr.v5i4.45270
⁴⁵ Díaz Carrasco JM, Redondo EA, Pin Viso ND, Redondo LM, Farber MD, Fernández Miyakawa ME. Tannins and bacitracin differentially modulate gut microbiota of broiler chickens. BioMed Research International. 2018;2018:1879168. https://doi.org/10.1155/2018/1879168
» https://doi.org/10.1155/2018/1879168
⁴⁶ Yu Y, Zhao H, Lin J, Li Z, Tian G, Yang YY, et al. Repurposing non-antibiotic drugs auranofin and pentamidine in combination to combat multidrug-resistant gram-negative bacteria. International Journal of Antimicrobial Agents. 2022;59(5)106582. https://doi.org/10.1016/j.ijantimicag.2022.106582
» https://doi.org/10.1016/j.ijantimicag.2022.106582
⁴⁷ Aranda MIR, Gómez GAT, De Barros M, Dos Santos MH, De Oliveira LL, Pena JL, et al. Antimicrobial and synergistic activity of 2,2’,4-trihydroxybenzophenone against bacterial pathogens of poultry. Frontiers in Microbiology. 2019;10:490. https://doi.org/10.3389/fmicb.2019.00490
» https://doi.org/10.3389/fmicb.2019.00490
⁴⁸ Li BB, Zhi LL, Peng ZY, Ma XX, Li J. Contrasting distribution of antibiotic resistance genes and microbial communities in suspended activated sludge versus attached biofilms in an integrated fixed film activated sludge (IFAS) system. Science of the Total Environment. 2020;742:140481. https://doi.org/10.1016/j.scitotenv.2020.140481
» https://doi.org/10.1016/j.scitotenv.2020.140481
⁴⁹ Diarra MS, Silversides FG, Diarrassouba F, Pritchard J, Masson L, Brousseau R, et al. Impact of feed supplementation with antimicrobial agents on growth performance of broiler chickens, Clostridium perfringens and enterococcus counts, and antibiotic resistance phenotypes and distribution of antimicrobial resistance determinants in Escherichia coli isolates. Applied and Environmental Microbiology. 2007;73(20):6566–6576. https://doi.org/10.1128/AEM.01086-07
» https://doi.org/10.1128/AEM.01086-07
⁵⁰ Yang C, Rehman MA, Yin X, Carrillo CD, Wang Q, Yang C, et al. Antimicrobial resistance phenotypes and genotypes of Escherichia coli isolates from broiler chickens fed encapsulated cinnamaldehyde and citral. Journal of Food Protection. 2021;84(8):1385–1399. https://doi.org/10.4315/JFP-21-033
» https://doi.org/10.4315/JFP-21-033
⁵¹ Shen W, Chen Y, Wang N, Wan P, Peng Z, Zhao H, et al. Seasonal variability of the correlation network of antibiotics, antibiotic resistance determinants, and bacteria in a wastewater treatment plant and receiving water. Journal of Environmental Management. 2022;317:115362. https://doi.org/10.1016/j.jenvman.2022.115362
» https://doi.org/10.1016/j.jenvman.2022.115362
⁵² Bengtsson-Palme J, Kristiansson E, Larsson DGJ. Environmental factors influencing the development and spread of antibiotic resistance. FEMS Microbiology Reviews. 2018;42(1):68–80. https://doi.org/0.1093/femsre/fux053
» https://doi.org/0.1093/femsre/fux053
⁵³ Xu F, Zeng X, Hinenoya A, Lin J. MCR-1 confers cross-resistance to bacitracin, a widely used in-feed antibiotic. mSphere. 2018;3(5):e00411-18. https://doi.org/10.1128/msphere.00411-18
» https://doi.org/10.1128/msphere.00411-18
⁵⁴ Frost I, Laxminarayan R, McKenna N, Chai S, Joshi J. World Health Organization. Technical serie on primary health care: Antimicrobial resistance and primary health care. [Internet]. 2018;62p. Available from: https://iris.who.int/bitstream/handle/10665/326454/WHO-HIS-SDS-2018.56-eng.pdf
» https://iris.who.int/bitstream/handle/10665/326454/WHO-HIS-SDS-2018.56-eng.pdf
⁵⁵ Agga GE, Kasumba J, Loughrin JH, Conte ED. Anaerobic digestion of tetracycline spiked livestock manure and poultry litter increased the abundances of antibiotic and heavy metal resistance genes. Frontiers in Microbiology. 2020;11:614424. https://doi.org/10.3389/fmicb.2020.614424
» https://doi.org/10.3389/fmicb.2020.614424
⁵⁶ Ramos PI, Picão RC, Vespero EC, Pelisson M, Zuleta LF, Almeida LG, Gerber AL, Vasconcelos AT, Gales AC, Nicolás MF. Pyrosequencing-based analysis reveals a novel capsular gene cluster in a KPC-producing Klebsiella pneumoniae clinical isolate identifoed in Brazil. BMC Microbiology. 2012, 12:173. https://doi.org/10.1186/1471-2180-12-173
» https://doi.org/10.1186/1471-2180-12-173

Edited by

Editor:
Rondineli P. Barbero

Publication Dates

Publication in this collection
03 Mar 2025
Date of issue
2025

History

Received
07 May 2024
Accepted
11 Oct 2024
Published
06 Feb 2025

This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

[1] ¹ van Cuong N, Kiet BT, Hien VB, Truong BD, Phu DH, Thwaites G, et al. Antimicrobial use through consumption of medicated feeds in chicken flocks in the Mekong Delta of Vietnam: A three-year study before a ban on antimicrobial growth promoters. PLoS One. 2021;16(4): e0250082. http://doi.org/10.1371/journal.pone.0250082
» https://doi.org/10.1371/journal.pone.0250082

[2] ² Langata LM, Maingi JM, Musonye HA, Kiiru J, Nyamache AK. Antimicrobial resistance genes in Salmonella and Escherichia coli isolates from chicken droppings in Nairobi, Kenya. BMC Research Notes. 2019;12(1):22. https://doi.org/10.1186/s13104-019-4068-8
» https://doi.org/10.1186/s13104-019-4068-8

[3] ³ Farooq M, Smoglica C, Ruffini F, Soldati L, Marsilio F, Di Francesco CE. Antibiotic resistance genes occurrence in conventional and antibiotic-free poultry farming, Italy. Animals (Basel). 2022;12(18):2310. https://doi.org/10.3390/ani12182310
» https://doi.org/10.3390/ani12182310

[4] ⁴ Huemer M, Mairpady Shambat S, Brugger SD, Zinkernagel AS. Antibiotic resistance and persistence - Implications for human health and treatment perspectives. EMBO Reports. 2020;21(12): e51034. https://doi.org/10.15252/embr.202051034
» https://doi.org/10.15252/embr.202051034

[5] ⁵ Larsson DGJ, Flach CF. Antibiotic resistance in the environment. Nature Reviews Microbiology. 2022;20(5):257–269. https://doi.org/10.1038/s41579-021-00649-x
» https://doi.org/10.1038/s41579-021-00649-x

[6] ⁶ Alalam H, Graf FE, Palm M, Abadikhah M, Zackrisson M, Boström J, et al. A high-throughput method for screening for genes controlling bacterial conjugation of antibiotic resistance. mSystems. 2020;5(6):e01226-20. https://doi.org/10.1128/mSystems.01226-20
» https://doi.org/10.1128/mSystems.01226-20

[7] ⁷ Oladeinde A, Abdo Z, Zwirzitz B, Woyda R, Lakin SM, Press MO, et al. Litter commensal bacteria can limit the horizontal gene transfer of antimicrobial resistance to Salmonella in chickens. Applied and Environmental Microbiology. 2022;88(9):e0251721. https://doi.org/10.1128/aem.02517-21
» https://doi.org/10.1128/aem.02517-21

[8] ⁸ Virolle C, Goldlust K, Djermoun S, Bigot S, Lesterlin C. Plasmid transfer by conjugation in Gram-negative bacteria: From the cellular to the community level. Genes (Basel). 2020;11(11):1239. https://doi.org/10.3390/genes11111239
» https://doi.org/10.3390/genes11111239

[9] ⁹ Lima T, Domingues S, Silva GJ Da. Manure as a potential hotspot for antibiotic resistance dissemination by horizontal gene transfer events. Veterinary Sciences. 2020;7(3):110. https://doi.org/10.3390/vetsci7030110
» https://doi.org/10.3390/vetsci7030110

[10] ¹⁰ Vumazonke S, Khamanga SM, Ngqwala NP. Detection of pharmaceutical residues in surface waters of the Eastern Cape Province. International Journal of Environmental Research and Public Health. 2020;17(11)4067. https://doi.org/10.3390/ijerph17114067
» https://doi.org/10.3390/ijerph17114067

[11] ¹¹ Ngogang MP, Ernest T, Kariuki J, Mouiche MMM, Ngogang J, Wade A, et al. Microbial contamination of chicken litter manure and antimicrobial resistance threat in an urban area setting in Cameroon. Antibiotics (Basel). 2021;10(1):20. https://doi.org/10.3390/antibiotics10010020
» https://doi.org/10.3390/antibiotics10010020

[12] ¹² Wang L, Chai B. Fate of antibiotic resistance genes and changes in bacterial community with increasing breeding scale of layer manure. Frontiers in Microbiology. 2022;13:857046. https://doi.org/10.3389/fmicb.2022.857046
» https://doi.org/10.3389/fmicb.2022.857046

[13] ¹³ Oxendine A, Walsh AA, Young T, Dixon B, Hoke A, Rogers EE, et al. Conditions necessary for the transfer of antimicrobial resistance in poultry litter. Antibiotics (Basel). 2023;12(6):1006. https://doi.org/10.3390/antibiotics12061006
» https://doi.org/10.3390/antibiotics12061006

[14] ¹⁴ Chen Q, An X, Li H, Su J, Ma Y, Zhu YG. Long-term field application of sewage sludge increases the abundance of antibiotic resistance genes in soil. Environment International. 2016;92–93:1–10. https://doi.org/10.1016/j.envint.2016.03.026
» https://doi.org/10.1016/j.envint.2016.03.026

[15] ¹⁵ Duan M, Gu J, Wang X, Li Y, Zhang R, Hu T, et al. Factors that affect the occurrence and distribution of antibiotic resistance genes in soils from livestock and poultry farms. Ecotoxicology and Environmental Safety. 2019;180:114–122. https://doi.org/10.1016/j.ecoenv.2019.05.005
» https://doi.org/10.1016/j.ecoenv.2019.05.005

[16] ¹⁶ Fatoba DO, Abia ALK, Amoako DG, Essack SY. Rethinking manure application: Increase in multidrug-resistant enterococcus spp. in agricultural soil following chicken litter application. Microorganisms. 2021;9(5):885. https://doi.org/10.3390/microorganisms9050885
» https://doi.org/10.3390/microorganisms9050885

[17] ¹⁷ Lentz SAM. Atualização sobre Uso Racional de Antimicrobianos e Boas Práticas de Produção. Opas/Mapa. 2022;1–50. Available from: https://www.gov.br/agricultura/pt-br/assuntos/insumos-agropecuarios/insumos-pecuarios/resistencia-aos-antimicrobianos/publicacoes/Apostila_AtualizaosobreUsoRacionaldeAntimicrobianoseBoasPrticasdeProduo.pdf
» https://www.gov.br/agricultura/pt-br/assuntos/insumos-agropecuarios/insumos-pecuarios/resistencia-aos-antimicrobianos/publicacoes/Apostila_AtualizaosobreUsoRacionaldeAntimicrobianoseBoasPrticasdeProduo.pdf

[18] ¹⁸ Brasil. Instrução Normativa Nº26, de 10 de julho de 2009. Ministério da Agricultura Pecuária e Abastecimento - MAPA. 2009;9. https://wikisda.agricultura.gov.br/dipoa_baselegal/in_9-2009_listeria.pdf
» https://wikisda.agricultura.gov.br/dipoa_baselegal/in_9-2009_listeria.pdf

[19] ¹⁹ Brasil. Instrução Normativa Nº 45, De 22 De Novembro De 2016. Dou. 2016;4. https://www.gov.br/agricultura/pt-br/assuntos/insumos-agropecuarios/insumos-pecuarios/alimentacao-animal/arquivos-alimentacao-animal/legislacao/instrucao-normativa-no-45-de-22-de-novembro-de-2016.pdf
» https://www.gov.br/agricultura/pt-br/assuntos/insumos-agropecuarios/insumos-pecuarios/alimentacao-animal/arquivos-alimentacao-animal/legislacao/instrucao-normativa-no-45-de-22-de-novembro-de-2016.pdf

[20] ²⁰ Brasil. Ministério da Saúde. Plano de Ação Nacional de Prevenção e Controle da Resistência aos Antimicrobianos no Âmbito da Saúde Única. 2019;1. https://bvsms.saude.gov.br/bvs/publicacoes/plano_prevencao_resistencia_antimicrobianos.pdfantimicrobianos/plano-nacional-antimicrobianos-pan-br-14fev19-isbn.pdf/view
» https://bvsms.saude.gov.br/bvs/publicacoes/plano_prevencao_resistencia_antimicrobianos.pdfantimicrobianos/plano-nacional-antimicrobianos-pan-br-14fev19-isbn.pdf/view

[21] ²¹ Rabello RF, Bonelli RR, Penna BA, Albuquerque JP, Souza RM, Cerqueira AMF. Antimicrobial resistance in farm animals in Brazil: An update overview. Animals (Basel). 2020;10(4):552. https://doi.org/10.3390/ani10040552
» https://doi.org/10.3390/ani10040552

[22] ²² SENAI. Manual de Segurança e Qualidade para a Avicultura de Postura Manual de Segurança e Qualidade para a Avicultura de Postura. Embrapa. 2004;1–100.

[23] ²³ Subirats J, Murray R, Scott A, Lau CHF, Topp E. Composting of chicken litter from commercial broiler farms reduces the abundance of viable enteric bacteria, Firmicutes, and selected antibiotic resistance genes. Science of the Total Environment. 2020;746:141113. https://doi.org/10.1016/j.scitotenv.2020.141113
» https://doi.org/10.1016/j.scitotenv.2020.141113

[24] ²⁴ Trindade, P. R. C. M., Dolabella, S. S., Jain, S., Nascimento, L. F. . de J., Sacramento, A. . G., Barbosa, F. H. F., & Teixeira Barbosa, A. A. (2024). Ocorrência e persistência de genes de resistência a antibióticos em estações de tratamento de esgoto em Aracaju/SE/Brasil. Scientia Plena, 20(10). https://doi.org/10.14808/sci.plena.2024.106201
» https://doi.org/10.14808/sci.plena.2024.106201

[25] ²⁵ Limayem A, Micciche A, Nayak B, Mohapatra S. Prokaryotic community profling of local algae wastewaters using advanced 16S rRNA gene sequencing. Environmental Science and Pollution Research. 2018;25(1):704–711. https://doi.org/10.1007/s11356-017-0078-z
» https://doi.org/10.1007/s11356-017-0078-z

[26] ²⁶ Cornejo J, Yevenes K, Avello C, Pokrant E, Maddaleno A, Martin BS, et al. Determination of chlortetracycline residues, antimicrobial activity and presence of resistance genes in droppings of experimentally treated broiler chickens. Molecules. 2018;23(6):1264. https://doi.org/10.3390/molecules23061264
» https://doi.org/10.3390/molecules23061264

[27] ²⁷ Jia J, Guan Y, Cheng M, Chen H, He J, Wang S, et al. Occurrence and distribution of antibiotics and antibiotic resistance genes in Ba River, China. Science of the Total Environment. 2018;642:1136–1144. https://doi.org/10.1016/j.scitotenv.2018.06.149
» https://doi.org/10.1016/j.scitotenv.2018.06.149

[28] ²⁸ Furlan JPR, dos Santos LDR, Moretto JAS, Ramos MS, Gallo IFL, Alves G de AD, et al. Occurrence and abundance of clinically relevant antimicrobial resistance genes in environmental samples after the Brumadinho dam disaster, Brazil. Science of the Total Environment. 2020;726:138100. https://doi.org/10.1016/j.scitotenv.2020.138100
» https://doi.org/10.1016/j.scitotenv.2020.138100

[29] ²⁹ Ayandiran TO, Falgenhauer L, Schmiede J, Chakraborty T, Ayeni FA. High resistance to tetracycline and ciprofloxacin in bacteria isolated from poultry farms in Ibadan, Nigeria. Journal of Infection in Developing Countries. 2018;12(6):462–470. https://doi.org/10.3855/jidc.9862
» https://doi.org/10.3855/jidc.9862

[30] ³⁰ Collignon PJ, McEwen SA. One health-its importance in helping to better control antimicrobial resistance. Tropical Medicine and Infectious Disease. 2019;4(1):22. https://doi.org/10.3390/tropicalmed4010022
» https://doi.org/10.3390/tropicalmed4010022

[31] ³¹ Gibson JS, Wai H, Oo SSML, Hmwe EMM, Wai SS, Htun LL, et al. Antimicrobials use and resistance on integrated poultry-fish farming systems in the Ayeyarwady Delta of Myanmar. Scientific Reports. 2020;10(1):16149. https://doi.org/10.1038/s41598-020-73076-2
» https://doi.org/10.1038/s41598-020-73076-2

[32] ³² Anyanwu MU, Jaja IF, Okpala COR, Jaja CJI, Oguttu JW, Chah KF, et al. Potential sources and characteristic occurrence of mobile colistin resistance (mcr) gene-harbouring bacteria recovered from the poultry sector: A literature synthesis specific to high-income countries. PeerJ. 2021;9:e11606. https://doi.org/10.7717/peerj.11606
» https://doi.org/10.7717/peerj.11606

[33] ³³ Wang Y, Lyu N, Liu F, Liu WJ, Bi Y, Zhang Z, et al. More diversified antibiotic resistance genes in chickens and workers of the live poultry markets. Environment International. 2021;153:106534. https://doi.org/10.1016/j.envint.2021.106534
» https://doi.org/10.1016/j.envint.2021.106534

[34] ³⁴ Xu S, Lu W, Qasim MZ. High-throughput characterization of the expressed antibiotic resistance genes in sewage sludge with transcriptional analysis. Ecotoxicology and Environmental Safety. 2020;205:111377. https://doi.org/10.1016/j.ecoenv.2020.111377
» https://doi.org/10.1016/j.ecoenv.2020.111377

[35] ³⁵ Yang Q, Tian T, Niu T, Wang P. Molecular characterization of antibiotic resistance in cultivable multidrug-resistant bacteria from livestock manure. Environmental Pollution. 2017 Oct 1;229:188–198. https://doi.org/10.1016/j.envpol.2017.05.073
» https://doi.org/10.1016/j.envpol.2017.05.073

[36] ³⁶ Leungtongkam U, Thummeepak R, Tasanapak K, Sitthisak S. Acquisition and transfer of antibiotic resistance genes in association with conjugative plasmid or class 1 integrons of Acinetobacter baumannii PLoS One. 2018;13(12):e0208468. https://doi.org/10.1371/journal.pone.0208468
» https://doi.org/10.1371/journal.pone.0208468

[37] ³⁷ Dionisio F, Zilhão R, Gama JA. Interactions between plasmids and other mobile genetic elements affect their transmission and persistence. Plasmid. 2019;102:29–36. https://doi.org/10.1016/j.plasmid.2019.01.003
» https://doi.org/10.1016/j.plasmid.2019.01.003

[38] ³⁸ Karim MR, Zakaria Z, Hassan L, Mohd Faiz N, Ahmad NI. Antimicrobial resistance profiles and co-existence of multiple antimicrobial resistance genes in mcr-harbouring colistin-resistant enterobacteriaceae isolates recovered from poultry and poultry meats in Malaysia. Antibiotics (Basel). 2023;12(6):1060. https://doi.org/10.3390/antibiotics12061060
» https://doi.org/10.3390/antibiotics12061060

[39] ³⁹ OIE. World Organisation for Animal Health. List of Antimicrobial Agents of Veterinary Importance. 2021, (Resolution No. XXVIII) Available from: https://www.woah.org/app/uploads/2021/06/a-oie-list-antimicrobials-june2021.pdf
» https://www.woah.org/app/uploads/2021/06/a-oie-list-antimicrobials-june2021.pdf

[40] ⁴⁰ Belote BL, Tujimoto-Silva A, Hümmelgen PH, Sanches AWD, Wammes JCS, Hayashi RM, et al. Histological parameters to evaluate intestinal health on broilers challenged with Eimeria and Clostridium perfringens with or without enramycin as growth promoter. Poultry Science. 2018;97(7):2287–2294. https://doi.org/10.3382/ps/pey064
» https://doi.org/10.3382/ps/pey064

[41] ⁴¹ Yang Y, Ashworth AJ, Willett C, Cook K, Upadhyay A, Owens PR, et al. Review of antibiotic resistance, ecology, dissemination, and mitigation in U.S. broiler poultry systems. Frontiers in Microbiology. 2019;10:2639. https://doi.org/10.3389/fmicb.2019.02639
» https://doi.org/10.3389/fmicb.2019.02639

[42] ⁴² Umair M, Orubu S, Zaman MH, Wirtz VJ, Mohsin M. Veterinary consumption of highest priority critically important antimicrobials and various growth promoters based on import data in Pakistan. PLoS One. 2022;17(9):e0273821. http://doi.org/10.1371/journal.pone.0273821
» https://doi.org/10.1371/journal.pone.0273821

[43] ⁴³ Basit MA, Kadir AA, Loh TC, Aziz SA, Salleh A, Zakaria ZA, et al. Comparative efficacy of selected phytobiotics with halquinol and tetracycline on gut morphology, ileal digestibility, cecal microbiota composition and growth performance in broiler chickens. Animals (Basel). 2020;10(11):2150. https://doi.org/10.3390/ani10112150
» https://doi.org/10.3390/ani10112150

[44] ⁴⁴ Habib MA, Haque MA, Islam MS, Liton MR. Effect of dietary Halquinol supplementation on the productive performances, carcass traits and blood profile of Sonali chicken. Asian Journal of Medical and Biological Research. 2020;5(4):316–323. https://doi.org/10.3329/ajmbr.v5i4.45270
» https://doi.org/10.3329/ajmbr.v5i4.45270

[45] ⁴⁵ Díaz Carrasco JM, Redondo EA, Pin Viso ND, Redondo LM, Farber MD, Fernández Miyakawa ME. Tannins and bacitracin differentially modulate gut microbiota of broiler chickens. BioMed Research International. 2018;2018:1879168. https://doi.org/10.1155/2018/1879168
» https://doi.org/10.1155/2018/1879168

[46] ⁴⁶ Yu Y, Zhao H, Lin J, Li Z, Tian G, Yang YY, et al. Repurposing non-antibiotic drugs auranofin and pentamidine in combination to combat multidrug-resistant gram-negative bacteria. International Journal of Antimicrobial Agents. 2022;59(5)106582. https://doi.org/10.1016/j.ijantimicag.2022.106582
» https://doi.org/10.1016/j.ijantimicag.2022.106582

[47] ⁴⁷ Aranda MIR, Gómez GAT, De Barros M, Dos Santos MH, De Oliveira LL, Pena JL, et al. Antimicrobial and synergistic activity of 2,2’,4-trihydroxybenzophenone against bacterial pathogens of poultry. Frontiers in Microbiology. 2019;10:490. https://doi.org/10.3389/fmicb.2019.00490
» https://doi.org/10.3389/fmicb.2019.00490

[48] ⁴⁸ Li BB, Zhi LL, Peng ZY, Ma XX, Li J. Contrasting distribution of antibiotic resistance genes and microbial communities in suspended activated sludge versus attached biofilms in an integrated fixed film activated sludge (IFAS) system. Science of the Total Environment. 2020;742:140481. https://doi.org/10.1016/j.scitotenv.2020.140481
» https://doi.org/10.1016/j.scitotenv.2020.140481

[49] ⁴⁹ Diarra MS, Silversides FG, Diarrassouba F, Pritchard J, Masson L, Brousseau R, et al. Impact of feed supplementation with antimicrobial agents on growth performance of broiler chickens, Clostridium perfringens and enterococcus counts, and antibiotic resistance phenotypes and distribution of antimicrobial resistance determinants in Escherichia coli isolates. Applied and Environmental Microbiology. 2007;73(20):6566–6576. https://doi.org/10.1128/AEM.01086-07
» https://doi.org/10.1128/AEM.01086-07

[50] ⁵⁰ Yang C, Rehman MA, Yin X, Carrillo CD, Wang Q, Yang C, et al. Antimicrobial resistance phenotypes and genotypes of Escherichia coli isolates from broiler chickens fed encapsulated cinnamaldehyde and citral. Journal of Food Protection. 2021;84(8):1385–1399. https://doi.org/10.4315/JFP-21-033
» https://doi.org/10.4315/JFP-21-033

[51] ⁵¹ Shen W, Chen Y, Wang N, Wan P, Peng Z, Zhao H, et al. Seasonal variability of the correlation network of antibiotics, antibiotic resistance determinants, and bacteria in a wastewater treatment plant and receiving water. Journal of Environmental Management. 2022;317:115362. https://doi.org/10.1016/j.jenvman.2022.115362
» https://doi.org/10.1016/j.jenvman.2022.115362

[52] ⁵² Bengtsson-Palme J, Kristiansson E, Larsson DGJ. Environmental factors influencing the development and spread of antibiotic resistance. FEMS Microbiology Reviews. 2018;42(1):68–80. https://doi.org/0.1093/femsre/fux053
» https://doi.org/0.1093/femsre/fux053

[53] ⁵³ Xu F, Zeng X, Hinenoya A, Lin J. MCR-1 confers cross-resistance to bacitracin, a widely used in-feed antibiotic. mSphere. 2018;3(5):e00411-18. https://doi.org/10.1128/msphere.00411-18
» https://doi.org/10.1128/msphere.00411-18

[54] ⁵⁴ Frost I, Laxminarayan R, McKenna N, Chai S, Joshi J. World Health Organization. Technical serie on primary health care: Antimicrobial resistance and primary health care. [Internet]. 2018;62p. Available from: https://iris.who.int/bitstream/handle/10665/326454/WHO-HIS-SDS-2018.56-eng.pdf
» https://iris.who.int/bitstream/handle/10665/326454/WHO-HIS-SDS-2018.56-eng.pdf

[55] ⁵⁵ Agga GE, Kasumba J, Loughrin JH, Conte ED. Anaerobic digestion of tetracycline spiked livestock manure and poultry litter increased the abundances of antibiotic and heavy metal resistance genes. Frontiers in Microbiology. 2020;11:614424. https://doi.org/10.3389/fmicb.2020.614424
» https://doi.org/10.3389/fmicb.2020.614424

[56] ⁵⁶ Ramos PI, Picão RC, Vespero EC, Pelisson M, Zuleta LF, Almeida LG, Gerber AL, Vasconcelos AT, Gales AC, Nicolás MF. Pyrosequencing-based analysis reveals a novel capsular gene cluster in a KPC-producing Klebsiella pneumoniae clinical isolate identifoed in Brazil. BMC Microbiology. 2012, 12:173. https://doi.org/10.1186/1471-2180-12-173
» https://doi.org/10.1186/1471-2180-12-173

Sample	Municipality	Geographical location	Type of production	Duration of housing (days)	Growth promoter
G1	Estância	S 12°49'55'' W 38°32'33''	broiler	110	Enramycin 8%
G2	Estância	S 12°47'27'' W 38°40'55''	broiler	130	Enramycin 8%
G3	Estância	S 12°47'2'' W 38°37'45''	broiler	165	Enramycin 8%
G4	Estância	S 12°47'15'' W 38°40'55''	broiler	210	Enramycin 8%
G5	Umbaúba	S 12°38'49'' W 38°20'9''	broiler	240	Enramycin 8%
G6	Estância	S 12°46'54'' W 38°38'16''	broiler	260	Enramycin 8%
G7	Nossa Senhora da Glória	S 11°41'59'' W 38°34'42''	broiler	42	Uninformed
G8	Carira	S 11°34'7'' W 38°10'43''	broiler	45	Halquinol + Monensin³
G9	Campo do Brito	S 11°12'38'' W 38°20'29''	broiler	52	Salinomycin⁴
G10	Frei Paulo	S 11°28'9'' W 38°29'53''	broiler	120	Halquinol + Salinomycin
G11¹	Areia Branca	S 11°14'6'' W 38°40'50''	laying	21	Halquinol + Salinomycin
G12¹	Areia Branca	S 11°14'6'' W 38°40'50''	laying	70	Halquinol + Salinomycin
G13²	Areia Branca	S 11°13'39'' W 38°37'48''	laying	140	Zinc Bacitracin
G14²	Areia Branca	S 11°13'39'' W 38°37'48''	laying	546	Zinc Bacitracin

Gene	Primer	Sequence (5' → 3')	Annealing Temperature (°C)	Amplification Length (bp)	Source
16S rRNA	FW RV	AGAGTTTGATCCTGGCTCAG GGTTACCTTGTTACGACTT	55	1500	²⁵
tetA	FW RV	GCTACATCCTGCTTGCCTTC CATAGATCGCCGTGAAGAGG	58	210	²⁶
tetB	FW RV	TTGGTTAGGGGCAAGTTTTG GTAATGGGCCAATAACACCG	55	659	²⁶
tetG	FW RV	GCTCGGTGGTATCTCTGCTC AGCAACAGAATCGGGAACAC	58	468	²⁶
tetM	FW RV	TTTATCTGTATCACCGCTTCCG ACAATCCGTCACATTCCAACC	60	154	²⁷
gyrA	FW RV	AGCGACCTTGCGAGAGAAAT GGAACCGAAGTTACCCTGACC	60	330	²⁷
qnrS	FW RV	TTGCCCATCAAGTGAGTAATCG AGGATAAACAACAATACCCAGTGC	60	341	²⁷
blaTEM	FW RV	CATTTCCGTGTCGCCCTTATTC CGTTCATCCATAGTTGCCTGAC	60	800	²⁸
ermB	FW RV	TAACGACGAAACTGGCTAAAATAAG AACATCTGTGGTATGGCGGG	60	419	²⁷
sul-1	FW RV	CGCACCGGAAACATCGCTGCAC TGAAGTTCCGCCGCAAGGCTCG	56	163	²⁷
mcrA	FW RV	CGGTCAGTCCGTTTGTTC CTTGGTCGGTCTGTAGGG	55	309	²⁹

Gene	Reference strain: species and source	Identity (%)	GenBank Access Number	Aligned Region	Gene Location
tetA	Escherichia coli PBM64, tetAtetracycline efflux transporter MFS gene, partial cds.	100	OQ625508.1	2 a 210	1 ..210
	Shigella flexneri 2nd strain Sflex 21-42, unnamed plasmid 4, complete sequence.	100	CP121221.1	21440 a 21648	21318..22517
	Salmonella enterica subsp. enterica serovar Uganda strain RM018, plasmid pRM018_1, complete sequence.	100	CP117383.1	26328 a 26536	26206..27405
	Klebsiella pneumoniae strain IM007 plasmid plM007_ESBL, complete sequence.	100	CP095430.1	8091 a 8299	7222..8421
tetB	Acinetobacter baumannii strain S402, tetB gene, partial cds.	100	MK506781.1	1 a 656	1..656
	Vibrio cholerae strain BY369, plasmid pBY369-1, complete sequence.	99,85	CP090380.1	35342 a 35999	35190..36395
	Avibacterium paragallinarum strain AG21-0333, chromosome, complete genome.	99,85	CP104914.1	81099 a 81756	80703..81908
	Escherichia coli strain CMCY6 tetracycline efux MFS transporter gene, tet(B) allele, complete cds.	99,85	OM977025.1	397 a 1054	1..1206
tetG	Uncultured bacteria clone G0-10 class G tetracycline resistance protein gene (tetG), partial cds.	92,27	KJ603177.1	2 a 415	1..468
	Proteus mirabilis HN2p strain, HN2p chromosome, complete sequence.	90,34	CP046048.1	5799 a 6212	5346..6521
	Pseudomonas aeruginosa strain AR_0111, chromosome, complete genome.	90,34	CP032257.1	2703701 a 2704114	2703248..2704423
	Klebsiella pneumoniae strain 309074, plasmid p309074-1, complete sequence.	90,34	CP030297.1	99949 a 100362	99496..100671
tetM	Streptococcus agalactiae strain PHEGBS0463, transposon Tn7539, complete sequence.	95,79	OP715847.1	19907 a 20001	18569..20488
	Enterococcus faecalis strain W5, plasmid pW5-2, complete sequence.	95,79	CP118757.1	8140 a 8234	7653..9572
	Gallibacterium anatis strain IMT49310, chromosome, complete genome.	95,79	CP110225.1	1611696 a 1611790	1611209..1613128
	Staphylococcus aureus, chromosome N09CSA16, complete genome.	95,79	CP091525.1	1671366 a 1671460	1670028..1671947
gyrA	Escherichia coli strain 128, DNA gyrase A (gyrA) gene, partial cds.	100	KC493126.1	1 a 328	1..626
	Salmonella sp. Chromosome S13, complete genome.	100	CP047094.1	2928257 a 2928585	2925962..2928589
	Shigella flexneri strain B36 DNA gyrase subunit A (gyrA) gene, partial cds.	99,35	KU586842.1	1 a 309	1..645
	Shigella dysenteriae strain NK3898, DNA gyrase subunit A (gyrA) gene, partial cds.	99,68	KU586846.1	1 a 309	1..645
qnrS	Klebsiella pneumoniae isolate KSH203, plasmid pKSH203-qnrS, complete sequence.	100	CP034326.1	146224 a 146562	146216..146872
	Pseudomonas aeruginosa, plasmid pP6qnrS1, complete sequence.	100	MH061383.1	68516 a 68854	68206..68862
	Enterobacter cloacae strain 3849, plasmid p3846_IncN_VIM-1, complete sequence.	100	CP052872.1	16839 a 17177	16529..17185
	Escherichia coli MN067 qnrS gene for quinolone resistance pentapeptide repeat protein qnrS12, complete CDS	100	NG_059276.1	411 a 749	101..757
blaTEM	Escherichia coli strain BLG15, broad-spectrum plasmid class A beta-lactamase gene TEM-1(blaTEM), blaTEM-1 allele, complete cds.	99,71	OQ625507.1	80 a 763	1..861
	Klebsiella pneumoniae strain KPN6328, plasmid pK6328_1, complete sequence.	99,71	CP124838.1	98097 a 98780	98018..98878
	Acinetobacter baumannii strain Aba_C-34HGM2020 HAS family class A beta-lactamasegene(blaTEM), partial cds. lactamase (blaTEM), cds parciais.	99,71	OP745943.1	28 a 711	1..754
	Pseudomonas aeruginosa strain Emad-H6 family TEM beta-lactamase gene (blaTEM), partial cds.	99,71	OQ784849.1	80 a 763	1..857
ermB	Streptococcus suis strain STC78 ICensui78-tetOermBmobile element, complete sequence.	99,05	ON944185.1	26620 a 27038	1..55758
	Clostridium perfringens strain QHY-2, plasmid pQHY-2, complete sequence.	99,05	CP118266.1	20960 a 21378	20833..21570
	Enterococcus faecalis strain W5, plasmid pW5-2, complete sequence.	99,05	CP118757.1	62670 a 63088	62478..63215
	Gallibacterium anatis strain IMT49310, chromosome, complete genome	99,05	CP110225.1	1613935 a 1614353	1613808..1614545
sul-1	Enterobacter cloacae 2017-266 intl, blalMP-1, aac(6')-llc, qacEdeltal, sul-1 genes, complete cds.	100	LC508022.1	3763 a 3924	321 8..4057
	Escherichia coli strain E dihydropteroate synthase(sul-1) gene, partial cds.	100	MN527466.1	502 a 663	1..775
	Proteus mirabilis HN2p strain, HN2p chromosome, complete sequence.	100	CP046048.1	143413 a 143574	143280..144118
	Klebsiella pneumoniae strain THC-2, sulfonamide resistance protein sul-1 gene, partial cds.	100	MK620997.1	216 a 377	1..388
mcr-1	Klebsiella pneumoniae strain NH54, phosphoethanolamine-lipid A transferase (mcr-1) gene, complete cds.	100	MF149969.1	143 a 451	110..1735
	Escherichia coli strain HKSH_MCR_161114268_EC, phosphoethanolamine lipid A transferase gene (mcr-1 ), mcr1.9 allele, complete cds.	100	KY685071.1	34 a 342	1..1626
	Salmonella entérica subsp. entérica serovar Typhimurium strain P22, phosphoethanolamine transferase (mcr-1 ) gene, partial cds.	100	MH654791.1	69 a 377	36..693
	Raoultella ornithinolytica strain TS48CTX, plasmid pHNTS48-1, complete sequence.	100	MF135534.1	178989 a 179297	177705..179330

Antibiotic	Samples
Class	Gene	G1	G2	G3	G4	G5	G6	G7	G8	G9	G10	G11	G12	G13	G14	Total	%
	tetA	+	-	+	+	+	-	+	-	+	+	+	+	+	+	11	78,6
	tetB	+	-	+	-	+	-	+	-	-	+	+	+	+	+	9	64,3
Tetracyclines	tetG	+	-	+	+	+	-	+	-	+	+	+	+	+	+	11	78,6
	tetM	+	+	+	+	+	+	+	+	+	+	+	+	+	+	14	100
Quinolones	gyrA	+	+	+	+	+	+	+	+	+	+	+	+	+	+	14	100
Quinolones	qnrS	+	+	+	+	+	-	+	+	+	+	+	+	-	+	12	85,7
Beta-lactams	blaTEM	+	+	+	+	+	+	+	+	+	+	+	+	+	+	14	100
Macrolides	ermB	+	+	+	+	+	+	+	+	+	+	+	+	+	+	14	100
Sulfonamides	Sul-1	+	+	+	+	+	+	+	+	+	+	+	+	+	+	14	100
Polymyxins	mcr-1	+	+	+	+	+	+	-	-	+	-	+	+	+	-	10	71,4
	Total	10	7	10	9	10	6	9	6	9	9	10	10	9	10	123	87,86