Abstract

Milk’s qualitative and technological properties are greatly affected by genetic polymorphisms in the kappa-casein gene, and their polymorphisms may serve as informative markers of yield and composition. Thus, the objective of this study was to detect kappa-casein (kappa-CN) gene polymorphisms and their association with milk production traits in crossbred dairy cows. One hundred healthy crossbred (Friesian x Jenoubi) dairy animals between three and five years old were sampled for blood and milk during their first lactation. The genomic DNA was extracted from whole blood, and restriction fragment length polymorphism (RFLP-PCR) was used to determine the genotype of the kappa-CN gene. As a consequence of the restriction digestion of this fragment with Hind III, it showed three different restriction patterns: BB (453 base pairs uncut), AB (453, 206, and 225 base pairs), and AA (206 and 225 base pairs). Based on genetic diversity, the AB genotype was the most predominant (n = 67), with a frequency of 0.67. A variant genotype of the kappa-CN gene was associated with milk production traits in crossbred dairy cows. Animals with the AA variant produced a higher milk yield and a higher percentage of fat, casein, protein, and solids not fat (SNF) (P≤0.05) (1.397kg, 0.75%, 0.31%, 0.27%, and 0.68%, respectively) than those with the BB variant. A logistic regression analysis confirmed that the kappa-CN genotypes increase milk yield and casein content. Therefore, genetic variants of the kappa-CN gene could be used as genetic markers for improving milk production traits in dairy cattle.

Keywords:
cattle; genetic variants; milk protein

Resumo

As propriedades qualitativas e tecnológicas do leite são muito afetadas por polimorfismos genéticos no gene kappa-caseína e esses polimorfismos podem servir como marcadores informativos de rendimento e composição. Assim, o objetivo deste estudo foi detectar polimorfismos do gene kappa-caseína (kappa-CN) e sua associação com características de produção de leite em vacas leiteiras mestiças. Cem animais mestiços (Freisian x Jenoubi) saudáveis, entre três e cinco anos de idade, foram amostrados durante a primeira lactação para sangue e leite. O DNA genômico foi extraído do sangue total e o polimorfismo dos fragmentos de restrição do DNA genômico (RFLP-PCR) foi usado para determinar o genótipo do gene kappa-CN. Em consequência da digestão de restrição deste fragmento com Hind III, ele apresentou três padrões de restrição diferentes: BB (453 pares de bases não cortadas), AB (453,206 e 225 pares de bases) eAA (206 e 225 pares de bases). Com base na diversidade genética, o genótipo AB foi o mais predominante (n = 67), com frequência de 0,67. Genótipo variante do gene kappa-CN foi associado com características de produção de leite em vacas leiteiras mestiças. Animais com a variante AA tiveram maior produção de leite e maior percentual de gordura, caseína, proteína e sólidos não gordurosos (SNG) (P≤0,05) (l,397kg, 0,75%, 0,31%, 0,27% e 0,68%, respectivamente) do que aqueles com variante BB. Uma análise de regressão logística confirmou que os genótipos kappa-CN aumentam a produção de leite e o teor de caseína. Portanto, variantes genéticas do gene kappa-CN podem ser usadas como marcadores genéticos para melhorar as características de produção de leite em bovinos leiteiros.

Palavras-chave:
bovinos; variantes genéticas; proteína do leite

1. Introduction

Bovine milk protein is one of the main parameters for measuring the quality of milk (¹1 Ju Z, Huang J, Li Q, Wang H, Zhong J, Wang C. The polymorphisms of κ-casein gene and their associations with milk production traits and expression analysis in Chinese Holstein cattle. Afr J Biotechnol. 2011; 10(62): 13368-13375. https://doi.org/10.5897/AJB10.1886
https://doi.org/10.5897/AJB10.1886... ). It is primarily composed of four caseins: α-1, α-2, β, and kappa–caseins (insoluble fractions) and certain lactoglobulins (soluble fractions) (²2 Hamza AE, Wang XL, Yang ZP. Kappa casein gene polymorphism in Holstein Chinese cattle. Pak Vet J. 2010; 30(4): 203-206.). These milk proteins, which include αs1-casein, αs2-casein, β-casein, and k-casein, account for 80% of the total proteins; whey proteins, which consist of α-lactoalbumin and β-lactoglobulin, account for 20% of the total proteins. The six proteins listed above make up 95% of the total proteins in bovine milk (³3 Awad A, El Araby IE, El-Bayomi KM, Zaglool AW. Association of polymorphisms in kappa casein gene with milk traits in Holstein Friesian cattle. Jpn J Vet Res. 2016; 64(2): S39-S43. http://hdl.handle.net/2115/62028
http://hdl.handle.net/2115/62028... ). Milk productivity is associated with milk protein micelles formed by the kappa-casein, which is involved in the formation, stabilization, and aggregation of casein protein micelles and is therefore of great significance in cheese production (¹1 Ju Z, Huang J, Li Q, Wang H, Zhong J, Wang C. The polymorphisms of κ-casein gene and their associations with milk production traits and expression analysis in Chinese Holstein cattle. Afr J Biotechnol. 2011; 10(62): 13368-13375. https://doi.org/10.5897/AJB10.1886
https://doi.org/10.5897/AJB10.1886... ).

Many genes contribute to bovine milk production, and their expression depends on both genetic and environmental factors (⁴4 Hani HA, Al-Bazi WGM, Muhammed HA. Association of prolactin gene polymorphism with some biochemical and lactation traits in dairy cow in Karbala Province. Turkish Journal of Physiotherapy and Rehabilitation. 2021; 32(3)., ⁵5 Asmarasari SA, Sumantri C, Gunawan A, Taufik E, Anggraeni A, Hapsari AAR, Dewantoro B. Kappa casein (CSN3) gene polymorphism and its effect on cumulative milk yields of Holstein Friesian dairy cattle. In IOP Conference Series: Earth and Environmental Science. 2021; 902 (1): 012047. IOP Publishing. https://doi.org/10.1088/1755-1315/902/1/012047
https://doi.org/10.1088/1755-1315/902/1/... ). Among them is the bovine kappa-CN gene, which encodes kappa-casein proteins (⁷7 Sobar Poorrajabi Ghaziyani A, Mirhoseini SZ, Ghavi Hossein-Zadeh N, Ansari Pirsaraei Z, Dehghanzadeh H.Association of Kappa-Casein Gene Polymorphism with some Biochemical Blood Indicators in Guilan Native Cattle of Iran (Bos indicus). Iran J Appl Anim Sci. 2014; 4(4): 717-722., ⁸8 Trakovická A, Moravčíková N, Kasarda R. Casein polymorphism in relation to the milk production traits of Slovak spotted cattle. Agric Conspec Sci. 2017; 82(3): 255-258. https://hrcak.srce.hr/191836
https://hrcak.srce.hr/191836... ). This gene has a 13-kb sequence divided into five exons and is located on chromosome 6 (6q31) (⁶6 Rachagani S, Gupta ID. Bovine kappa-casein gene polymorphism and its association with milk production traits. Genet Mol Biol. 2008; 31(4): 893-897.). Their polymorphisms are important and well-documented due to their influence on the quantitative and technical characteristics of milk and could be used as a predictive molecular marker of milk yield and composition (²2 Hamza AE, Wang XL, Yang ZP. Kappa casein gene polymorphism in Holstein Chinese cattle. Pak Vet J. 2010; 30(4): 203-206., ⁸8 Trakovická A, Moravčíková N, Kasarda R. Casein polymorphism in relation to the milk production traits of Slovak spotted cattle. Agric Conspec Sci. 2017; 82(3): 255-258. https://hrcak.srce.hr/191836
https://hrcak.srce.hr/191836... ).

Several studies on different breeds of dairy cows have shown a relationship between the kappa-casein gene variation and milk yield, fat content, and protein content. Özdemir and Doğru (⁹9 Özdemir M, Doğru Ü. Relationship between kappa-casein polymorphism and production traits in Brown Swiss and Holstein. J Appl Anim Res. 2005; 27(2): 101-104. https://doi.org/10.1080/09712119.2005.9706549
https://doi.org/10.1080/09712119.2005.97... ) studied the effects of kappa-CN polymorphism on milk production traits in Brown Swiss, Holstein, and East Anatolian Red cows. This study provided evidence that fat yield and percentage can be increased by increasing the frequency of kappa-CN BB genotypes, whereas milk production can be maximized by increasing kappa-CN AB genotypes with selective breeding in herds. A higher frequency of kappa-CN BB genotypes in herds can also increase yield traits significantly. Furthermore, it was demonstrated that Holstein and Girolando cows with AB and BB genotypes of the kappa-CN gene had a higher milk fat content when compared to cows with AA genotypes (¹⁰10 Botaro BG, Lima YVRD, Cortinhas CS, Rennó FP, Santos MVD. Effect of the kappa-casein gene polymorphism, breed and seasonality on physicochemical characteristics, composition and stability of bovine milk. Revista Brasileira de Zootecnia. 2009; 38(12): 2447-2454.). Two allelic variants, A and B, of the bovine kappa-CN (CSN3) gene are determined by missense mutations in exon IV. The amino acids 136 and 148 differ between variants A and B. For A and B, threonine is replaced by isoleucine at position 136, and aspartic acid by alanine at position 148, respectively (¹¹11 Deb R, Singh U, Kumar S, Singh R, Sengar G, Sharma A. Genetic polymorphism and association of kappa-casein gene with milk production traits among Frieswal (HF × Sahiwal) cross breed of Indian origin. Iran J Vet Res. 2014; 15(4): 406.). In the study by Mir et al. (¹²12 Mir SN, Ullah O, Sheikh R. Genetic polymorphism of milk protein variants and their association studies with milk yield in Sahiwal cattle. Afr J Biotechnol. 2014; 13(4). https://doi.org/10.5897/AJB2013.13216
https://doi.org/10.5897/AJB2013.13216... ), the effect of s1 casein, β-casein, kappa-casein, α-lactalbumin, α-lactoglobulin, and β-lactoglobulin variations on milk yield was measured. Higher milk production was associated with the AB genotype identified in the kappa-CN gene. A polymorphism g.10888T>C could lead to the substitution of isoleucine for threonine in the kappa-CN protein in Chinese Holstein cattle that is associated with milk production traits (¹³13 Alim MA, Sun D, Zhang Y, Zhang Y, Zhang Q, Liu L. DNA Polymorphisms in the lactoglobulin and K-casein Genes Associated with Milk Production Traits on Dairy Cattle. Bioresearch Communications-(BRC). 2015; 1(2): 82-86.). In another study, PCR-RFLP analysis was used to test for genetic variants of the αS1-casein gene in Bulgarian Rhodopean cattle and their association with milk production and quality. The data showed that the three genotypes BB, CC, and BC accounted for 26.4%, 2.3%, and 71.3% of the population, respectively. Genetic variant BC was linked to cow milk production and milk butter, and genotype CC to fat and protein content (¹⁴14 Hristov JP, Teofanova D, Georgieva A, Radoslavov G. Effect of genetic polymorphism of αS1-casein gene on qualitative and quantitative milk traits in native Bulgarian Rhodopean cattle breed. Genet Mol Res. 2018; 17(1): gmr16039868. http://dx.doi.org/10.4238/gmr16039868
http://dx.doi.org/10.4238/gmr16039868... ). Based on the genetic variation on milk protein, Kyselová et al. (¹⁵15 Kyselová J, Ječmínková K, Matějíčková J, Hanuš O, Kott T, Štípková M, Krejčová M. Physiochemical characteristics and fermentation ability of milk from Czech Fleckvieh cows are related to genetic polymorphisms of β-casein, κ-casein, and β-lactoglobulin. Asian-Australas J Anim Sci. 2019; 32(1): 14. http://dx.doi.org/10.5713/ajas.17.0924
http://dx.doi.org/10.5713/ajas.17.0924... ) investigated the influence of β- and κ-casein and β-lactoglobulin genotypes in Czech Fleckvieh cattle on important milk physiochemical and technological characteristics such as acidity, alcohol stability, the contents of some minerals, and the parameters of acid fermentation ability (FEA). A significant association between genotype CSN3 and alcohol stability (AS) was found (P<0.05). As reported by Čítek et al. (¹⁶16 Čítek J, Hanusová L, Lískovcová L, Samková E, Hanuš O, Hasoňová L, Křížová Z, Večerek L. Polymorphisms in CSN3, CSN2 and LGB genes and their relation to milk production in dairy cattle in the Czech Republic. Acta Universitatis Agriculturae et Silviculturae Mendelianae Brunensis. 2019; 67(1): 19-24. https://doi.org/10.11118/actaun201967010019
https://doi.org/10.11118/actaun201967010... ), CSN3, CSN2, and LGB polymorphisms were associated with milk yields and fat and protein production for selected cattle breeds in the Czech Republic. Although the polymorphisms of the kappa-CN gene have been studied, little information is available on how they affect milk production in crossbred dairy cows. This study investigated the frequency of kappa-CN polymorphisms in crossbred dairy cows and their association with milk production traits.

2. Material and methods

2.1 Animals, phenotypic data, and milk collection

The study was conducted at Karbala University during the period from September 2019 to February 2020, following the international recommendations for the care and use of dairy cattle (¹⁷17 Federation of Animal Science Societies. Guide for the Care and Use of Agricultural Animals in Research and Teaching. Champaign, IL 61822, 3rd edition, 2010.), with approval number (Vet, No. 020,9,19). Crossbred (Friesian x Jenoubi) dairy cows with known pedigrees were included in the study. The study included 100 healthy crossbred dairy cows, aged between three and five years old; feeding and maintenance were identical for all animals. The data were classified according to parity (lactation I, II, III, and IV). All cows completed their lactations (305 days). Phenotypic data were collected from the laboratory of the dairy herd in Wasit Province, which included their age, milking records, lactation days, calving records, and sire and dam identification. In the studied herd, 2 sires were randomly allocated to mate with about 25–30 dams. A sample of 10 milliliters of milk was taken from each dairy cow and evaluated by an industrial scale milk analyzer (EKOMILK) to examine the fat, protein, casein, and solid portions of each milking. Descriptive statistics for the milk production trait are presented in Table 1.

2.1 DNA extraction and PCR-RFLP

Blood samples were collected from crossbred dairy cow flocks at the cattle station northeast of rural areas in Iraq (Waist Province). Blood was drawn and placed into tubes containing EDTA for genetic analysis. DNA was extracted from whole blood with a gSYNC™ DNA extraction kit (Geneaid, New Taipei City, Taiwan), following the manufacturer’s instructions, and then measured on a Nanodrop spectrophotometer (Biodrop, UK) at 260/280 absorbance ratios (¹⁸18 Al-Thuwaini TM. Body mass index and shortened telomere length in middle-aged female and male. Baghdad Sci J. 2022; 19(2), 0246-0246. http://dx.doi.org/10.21123/bsj.2022.19.2.0246
http://dx.doi.org/10.21123/bsj.2022.19.2... ). Polymerase chain reaction (PCR) was used to amplify a 453 bp fragment containing most of the exon IV coding region of the bovine kappa-CN gene. The primers for amplification of the kappa-CN gene fragments were reported by Barroso et al. (¹⁹19 Barroso A, Dunner S, Canon J. Detection of bovine kappa-casein variants A, B, C, and E by means of polymerase chain reaction-single strand conformation polymorphism (PCRSSCP). Journal of Animal Science. 1998; 76(6): 1535-1538. https://doi.org/10.2527/1998.7661535x
https://doi.org/10.2527/1998.7661535x... ), and their nucleotide sequences were as follows: (F) TGTGCTGAGTAGGTATCCTAGTTATGG and reverse (R) GCGTTGTCTTCTTTGATGTCT CCT. The PCR reaction was conducted using the Bioneer PCR premix (50 μM dNTPs, 10mM Tris-HCl (pH 9.0), 30mM KCl, 1.5mM MgCl2, and 1 U Top DNA polymerase) (²⁰20 Al-Thuwaini T. Association between polymorphism in BMP15 and GDF9 genes and impairing female fecundity in diabetes type 2. Middle East Fertil Soc J. 2020; 25(1): 1-10. https://doi.org/10.1186/s43043-020-00032-5
https://doi.org/10.1186/s43043-020-00032... ). In the PCR setup, the following conditions were used: denaturation at 94 °C for 4 min, 35 cycles of annealing, elongation, and extension (94 °C, 65 °C, and 72 °C for 1 min), and a final extension (72 °C for 5 min). Results were verified by electrophoresis of PCR products on 1.5% agarose gels and determination of gel images with a Chemidoc Gel Imager (Bio-Rad, USA). The PCR product was digested with Hind III restriction enzyme for the genotyping kappa-CN gene. Gene fragments were digested with restriction enzymes in a total volume of 20 μl (10 μl PCR product, 1 X enzyme buffers, 5 U enzymes, and distilled water) and subsequently incubated at 37 °C for 5 h. Electrophoresis on 2% agarose gels was used to detect restriction products (²¹21 Al-Thuwaini TM. Novel single nucleotide polymorphism in the prolactin gene of Awassi ewes and its role in the reproductive traits. Iraqi J Vet Sci. 2021; 35(3): 429-435. https://doi.org/10.33899/ijvs.2020.126973.1423
https://doi.org/10.33899/ijvs.2020.126973... ).

2.3 Statistical analysis

Genotype and allele frequency were calculated using PopGen32, version 1.31 (²²22 Yeh FC, Yang RC, Boyle T. POPGENE version 1.31, Microsoft Window-based Freeware for Population Genetic Analysis, Quick User Guide. Center for International Forestry Research, University of Alberta, Edmonton, Alberta, Canada, 1999.). Hardy-Weinberg equilibrium was calculated using the HWE law. Polymorphism information content (PIC) was calculated according to Botstein et al. (²³23 Botstein D, White RL, Skolnick M, Davis RW. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet. 1980; 32(3): 314.). Using the SPSS statistical program (SPSS 23.0 (NY, USA)), the following general linear model was used:

where Y_ijklm = the analyzed trait of each cow, μ = the mean of milk production traits, G_i = fixed effect of i^th genotypes (i = AA, AB, BB), P_j = fixed effect of j^th parity (j = 1, 2, 3, 4), A_k = fixed effect of k^th age group (3-4, >4-5), LM_l is the fixed effect of the l^th lactation month (l = Dec, Nov., and Oct.), DIM_m = days in milk as a covariate, and e_ijklm = random residual error. The Bonferroni adjusted p-values were used to evaluate statistically significant differences between means (P ≤0.05). Logistic regression analysis with the significance level set at P ≤ 0.05 was used to confirm the association between kappa-CN polymorphisms and milk production traits according to the following model: Logit $\left(\text{π}\right)=\text{α}+{\text{G}}_i+{\text{P}}_j+{\text{A}}_k+{\text{LM}}_l+{\beta }_{DIM}$;

where is the probability of milk production traits, α is the scale parameter of the trait, G_i is the fixed effect of the i^th genotype (i = AA, AB, BB), P_j is the fixed effect of the j^th parity (j = 1, 2, 3, 4), A_k = fixed effect of k^th age group (3-4, >4-5), LM_l is the fixed effect of the kth lactation month (l = Dec, Nov., and Oct.), and β_DIM is the covariate factor of the days in milk.

3. Results

3.1 Genotyping of kappa-CN gene and genetic diversity

PCR-RFLP analysis was performed on all samples using the Hind III restriction enzyme to assess variations in the kappa-CN gene. Hind III distinguished the two alleles, A and B, the latter remaining undigested (Figure 1). Through PCR-RFLP analysis, the A and B alleles of kappa-CN were identified by amplification of a 453 bp fragment located across exon IV Following restriction digestion, three restriction patterns were identified, referred to as BB (uncut 453 bp), AB (453 bp, 206, and 225 bp), and AA (206 and 225 bp) (Figure 1).

A study of the genetic diversity of Hind III -RFLP polymorphisms of the kappa-CN gene found that AB was the predominant genotype (n = 67), with a total frequency of 0.67. A total frequency of 0.20 (n = 20) was also determined for the AA genotype, and a frequency of 0.13 (n = 13) was determined for the BB genotype (Table 2). Considering information about polymorphism content (low polymorphism if PIC value < 0.25, moderate polymorphism if 0.25 < PIC value < 0.5, and high polymorphism if PIC value > 0.5), this study provided a moderate amount of information about the polymorphism. Based on the Chi-square test, the kappa-CN polymorphism appeared to significantly deviate from HWE (P≤0.05) (Table 2).

3.2 Association analyses of the kappa-CN gene

There were significant (P≤0.05) differences between the AA, AB, and BB genotypes concerning milk production traits. Animals with AA genotypes showed higher milk yield, percentage of fat, and solids not fat (SNF) (P≤0.05) than animals with AB and BB genotypes (Table 3). Univariate regression analyses further explored the association of kappa-CN genotypes with milk production traits (Table 4). The higher associated factors in milk yield and casein content were identified by multiple regression analyses, which indicated that the kappa-CN genotype had a beneficial influence on milk yield and casein content.

4. Discussion

A Chi-square test showed that the distribution of kappa-CN genotypes deviated from the Hardy-Weinberg equilibrium (P≤0.05). In livestock, genetic variation in the kappa-CN gene has been reported in several studies. Mir et al. (¹²12 Mir SN, Ullah O, Sheikh R. Genetic polymorphism of milk protein variants and their association studies with milk yield in Sahiwal cattle. Afr J Biotechnol. 2014; 13(4). https://doi.org/10.5897/AJB2013.13216
https://doi.org/10.5897/AJB2013.13216... ) investigated the effect of variation in α-s1 casein, β-casein, kappa-casein, α-lactalbumin, and β-lactoglobulin genes on milk yield. Milk protein genes are polymorphic, with α-casein C exhibiting a high allele frequency of 0.51, β-casein A showing 0.93, κ-casein A displaying 0.92, and α-lactalbumin B exhibiting 0.93; while β-lactoglobulin B exhibited a 0.91 allele frequency. Maletić et al. (²⁴24 Maletić M, Aleksić N, Vejnović B, Nikšić D, Kulić M, Đukić B, Ćirković D. Polymorphism of κ-casein and β-lactoglobulin genes in Busha and Holstein Friesian dairy cows in Serbia. Ml-jekarstvo: Casopis za Unaprjeđenje Proizvodnje i Prerade Mlijeka. 2016; 66(3): 198-205. https://doi.org/10.15567/ml-jekarstvo.2016.0304
https://doi.org/10.15567/ml-jekarstvo.20... ) used specific primers to identify genotypes of κ-casein. The digestion of fragments with specific endonucleases revealed three genotypes in Holstein Friesian cows: AA, AB, and BB, while only two genotypes were detected in Busha cows: AA and AB. In the AA genotype, the fragments were 156, 132, and 91 base pairs; in the AB genotype, the fragments were 288, 156, 132, and 91 base pairs; while in the BB genotype, the fragments were 288 and 91 base pairs. Concerning Holstein and Girolando cows, Kyselová et al. (¹⁵15 Kyselová J, Ječmínková K, Matějíčková J, Hanuš O, Kott T, Štípková M, Krejčová M. Physiochemical characteristics and fermentation ability of milk from Czech Fleckvieh cows are related to genetic polymorphisms of β-casein, κ-casein, and β-lactoglobulin. Asian-Australas J Anim Sci. 2019; 32(1): 14. http://dx.doi.org/10.5713/ajas.17.0924
http://dx.doi.org/10.5713/ajas.17.0924... ) investigated the level of polymorphism in the β- and κ-casein and β-lactoglobulin genes. In Holstein cows, the frequencies of genotypes AA, AB, and BB of k-casein are 66.83, 31.84, and 1.33 %, respectively, whereas in Girolando cows, the respective frequencies are 71.38, 27.90, and 0.72 %. Holstein cows (0.827 and 0.173) and Girolando cattle (0.853 and 0.17) had higher frequencies of the A allele than the B allele. Our results agree with the findings of (²⁵25 Molavi Choobini Z, Shadkhast M, Moshtaghi H, Habibian Dehkordi S, Shahbazkia HR. Polymorphism of κ-Casein Gene in Iranian Holsteins. Iran J Biotechnol. 2014; 12(1): 56-60. https://doi.org/10.5812/ijb.12118
https://doi.org/10.5812/ijb.12118... , ²⁶26 Bartonova P, Vrtkova I, Kaplanova K, Urban T. Association between CSN3 and BCO2 gene polymorphisms and milk performance traits in the Czech Fleckvieh cattle breed. Genet Mol Res. 2012; 11(2): 1058-1063. http://dx.doi.org/10.4238/2012.April.27.4
http://dx.doi.org/10.4238/2012.April.27.... ), who reported the predominance of the AB genotypes at 0.30 in Iranian Holstein cattle and 0.48 in Mexican Jersey cattle.

Association analysis of this study showed that individuals with the AA genotype had higher protein and casein, fat content, milk yield, and SNF than those with the AB genotype and BB genotype. The reason for this is that dairy cows possess two gene families that determine the properties of milk production, namely casein and whey (⁵5 Asmarasari SA, Sumantri C, Gunawan A, Taufik E, Anggraeni A, Hapsari AAR, Dewantoro B. Kappa casein (CSN3) gene polymorphism and its effect on cumulative milk yields of Holstein Friesian dairy cattle. In IOP Conference Series: Earth and Environmental Science. 2021; 902 (1): 012047. IOP Publishing. https://doi.org/10.1088/1755-1315/902/1/012047
https://doi.org/10.1088/1755-1315/902/1/... ). In bovine milk, casein is the main protein. It exists in several molecular forms. These proteins affect milk production and milk components (⁸8 Trakovická A, Moravčíková N, Kasarda R. Casein polymorphism in relation to the milk production traits of Slovak spotted cattle. Agric Conspec Sci. 2017; 82(3): 255-258. https://hrcak.srce.hr/191836
https://hrcak.srce.hr/191836... ). Casein genetic polymorphisms are crucial for milk production traits and have received considerable attention (²2 Hamza AE, Wang XL, Yang ZP. Kappa casein gene polymorphism in Holstein Chinese cattle. Pak Vet J. 2010; 30(4): 203-206.). Several studies have found that the AA genotype is also linked to higher milk production. Curi et al. (²⁷27 Curi RA, Oliveira HND, Gimenes MA, Silveira AC, Lopes CR. Effects of CSN3 and LGB gene polymorphisms on production traits in beef cattle. Genet Mol Biol. 2005; 28(2): 262-266.) reported that the κ-casein genotype AA is associated with higher milk production than the genotype BB, with heterozygous AB being intermediate. In addition, Trakovická et al. (²⁸28 Trakovická A, Moravčíková N, Navrátilová A. Kappa-casein gene polymorphism (CSN3) and its effect on milk production traits. Acta Fytotechnica et Zootechnica. 2012; 15(3).) indicate that genotype AA is positively associated with milk, protein, and fat yields, and the A allele is positively associated with milk production traits. In this regard, Zepeda-Batista et al. (²⁹29 Zepeda-Batista JL, Saavedra-Jiménez LA, Ruíz-Flores A, Núñez-Domínguez R, Ramírez-Valverde R. Potential influence of κ-casein and β-lactoglobulin genes in genetic association studies of milk quality traits. Asian-Australas J Anim Sci. 2017; 30(12): 1684. https://doi.org/10.5713/ajas.16.0481
https://doi.org/10.5713/ajas.16.0481... ) found that genotype AA in the CSN3 gene resulted in increased milk production in Holstein and Jersey breeds. The favorable effect of the AA genotype in the kappa-casein gene on proteins might be explained by amino acid differences in the mature protein, which may affect the biological properties of kappa-casein and its interactions with the other fractions in the casein micelles (¹¹11 Deb R, Singh U, Kumar S, Singh R, Sengar G, Sharma A. Genetic polymorphism and association of kappa-casein gene with milk production traits among Frieswal (HF × Sahiwal) cross breed of Indian origin. Iran J Vet Res. 2014; 15(4): 406.). A genetic variation in kappa-casein may also indicate that the mature protein is associated with other polymorphisms in non-coding sequences (promoter). A mutation could cause some alleles to express differently, such as the two main alleles of bovine cattle’s kappa-casein gene (³⁰30 Nowier AM, Ramadan SI. Association of β-casein gene polymorphism with milk composition traits of Egyptian Maghrebi camels (Camelus dromedarius). Arch Anim Breed. 2020; 63(2): 493-500. https://doi.org/10.5194/aab-63-493-2020
https://doi.org/10.5194/aab-63-493-2020... ).

5. Conclusions

Kappa–casein affects milk yield, protein levels, and fat contents. The CSN3 A variant is associated with milk production characteristics in crossbred dairy cows. Animals with AA genotypes produced higher milk yields with higher protein and fat percentages than those with AB and BB genotypes. This study demonstrated that the κ–casein gene could be used as a genetic marker in geneassisted selection programs to improve milk production traits in dairy cattle.

Acknowledgment

Thanks to each cow owner who assisted us in collecting milk and blood samples from their animals.

References

Publication Dates

History